Incidental Mutation 'R7969:Zfp281'
ID 650490
Institutional Source Beutler Lab
Gene Symbol Zfp281
Ensembl Gene ENSMUSG00000041483
Gene Name zinc finger protein 281
Synonyms
MMRRC Submission 046012-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7969 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 136552639-136557791 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 136553772 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 250 (V250D)
Ref Sequence ENSEMBL: ENSMUSP00000039003 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047734] [ENSMUST00000112046]
AlphaFold Q99LI5
Predicted Effect probably benign
Transcript: ENSMUST00000047734
AA Change: V250D

PolyPhen 2 Score 0.061 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000039003
Gene: ENSMUSG00000041483
AA Change: V250D

DomainStartEndE-ValueType
low complexity region 4 36 N/A INTRINSIC
low complexity region 83 95 N/A INTRINSIC
low complexity region 161 171 N/A INTRINSIC
low complexity region 180 191 N/A INTRINSIC
low complexity region 230 241 N/A INTRINSIC
ZnF_C2H2 258 280 3.34e-2 SMART
ZnF_C2H2 286 308 6.78e-3 SMART
ZnF_C2H2 314 336 1.43e-1 SMART
ZnF_C2H2 342 362 2.97e1 SMART
low complexity region 397 407 N/A INTRINSIC
low complexity region 488 501 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112046
AA Change: V250D

PolyPhen 2 Score 0.061 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000107677
Gene: ENSMUSG00000041483
AA Change: V250D

DomainStartEndE-ValueType
low complexity region 4 36 N/A INTRINSIC
low complexity region 83 95 N/A INTRINSIC
low complexity region 161 171 N/A INTRINSIC
low complexity region 180 191 N/A INTRINSIC
low complexity region 230 241 N/A INTRINSIC
ZnF_C2H2 258 280 3.34e-2 SMART
ZnF_C2H2 286 308 6.78e-3 SMART
ZnF_C2H2 314 336 1.43e-1 SMART
ZnF_C2H2 342 362 2.97e1 SMART
low complexity region 397 407 N/A INTRINSIC
low complexity region 488 501 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality between E7.5 and E8.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A T 13: 81,588,344 (GRCm39) V4414E possibly damaging Het
Ahcyl2 T A 6: 29,870,663 (GRCm39) I193N probably damaging Het
Amotl2 C T 9: 102,600,968 (GRCm39) T345I probably benign Het
Atf6b A T 17: 34,867,549 (GRCm39) probably null Het
Cacna1s T G 1: 136,004,470 (GRCm39) F337C probably damaging Het
Cep85l T C 10: 53,174,280 (GRCm39) I488V probably damaging Het
Cmas T A 6: 142,720,892 (GRCm39) D375E probably damaging Het
Cnga4 T C 7: 105,055,253 (GRCm39) F279S probably damaging Het
Cyp4f37 T C 17: 32,844,181 (GRCm39) V95A probably benign Het
Dao AGG AG 5: 114,153,270 (GRCm39) probably benign Het
Dlg2 T C 7: 92,066,466 (GRCm39) F235S probably benign Het
Dmxl2 T C 9: 54,354,165 (GRCm39) D427G possibly damaging Het
Efl1 T C 7: 82,342,178 (GRCm39) Y529H probably benign Het
Epx C T 11: 87,763,547 (GRCm39) M224I probably benign Het
Fetub A G 16: 22,748,449 (GRCm39) R101G possibly damaging Het
Fubp1 T A 3: 151,927,883 (GRCm39) probably null Het
Impdh2 C T 9: 108,439,505 (GRCm39) R153* probably null Het
Kcnj12 C T 11: 60,960,430 (GRCm39) Q243* probably null Het
Lrrn1 T A 6: 107,544,811 (GRCm39) V203E probably damaging Het
Meikin T C 11: 54,300,536 (GRCm39) S338P possibly damaging Het
Myl10 A T 5: 136,729,707 (GRCm39) probably null Het
Nt5c3b T C 11: 100,325,567 (GRCm39) K120E possibly damaging Het
Or10al2 T A 17: 37,983,547 (GRCm39) L211H probably damaging Het
Or2h1b T A 17: 37,462,077 (GRCm39) N262I possibly damaging Het
Or6c1 G A 10: 129,517,699 (GRCm39) T303I probably benign Het
Or6c75 T C 10: 129,337,716 (GRCm39) L313S probably benign Het
Pdzd7 A G 19: 45,024,664 (GRCm39) S452P probably benign Het
Prune2 A G 19: 17,179,034 (GRCm39) I2982V probably damaging Het
Ptpdc1 G A 13: 48,740,577 (GRCm39) R285C probably damaging Het
Raf1 T C 6: 115,597,249 (GRCm39) D486G probably damaging Het
Rbm27 A T 18: 42,408,545 (GRCm39) probably benign Het
Slit2 A G 5: 48,461,378 (GRCm39) Y1475C possibly damaging Het
Snx14 G A 9: 88,295,613 (GRCm39) T184M probably damaging Het
Tgm5 G T 2: 120,905,650 (GRCm39) N168K probably damaging Het
Ugt2b38 A G 5: 87,571,891 (GRCm39) V47A probably benign Het
Ush2a A G 1: 188,558,568 (GRCm39) H3599R probably benign Het
Veph1 T C 3: 66,122,896 (GRCm39) E211G possibly damaging Het
Wapl T A 14: 34,452,604 (GRCm39) H832Q probably damaging Het
Zfp36l2 A G 17: 84,493,252 (GRCm39) S462P unknown Het
Other mutations in Zfp281
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00531:Zfp281 APN 1 136,555,648 (GRCm39) missense probably damaging 1.00
IGL01408:Zfp281 APN 1 136,553,853 (GRCm39) missense probably damaging 1.00
IGL02037:Zfp281 APN 1 136,555,185 (GRCm39) missense possibly damaging 0.64
IGL03233:Zfp281 APN 1 136,554,567 (GRCm39) missense possibly damaging 0.82
PIT4486001:Zfp281 UTSW 1 136,554,741 (GRCm39) missense possibly damaging 0.48
R1514:Zfp281 UTSW 1 136,554,435 (GRCm39) missense probably benign 0.00
R1784:Zfp281 UTSW 1 136,553,091 (GRCm39) small insertion probably benign
R1785:Zfp281 UTSW 1 136,553,091 (GRCm39) small insertion probably benign
R2049:Zfp281 UTSW 1 136,553,091 (GRCm39) small insertion probably benign
R2142:Zfp281 UTSW 1 136,553,091 (GRCm39) small insertion probably benign
R4086:Zfp281 UTSW 1 136,553,859 (GRCm39) missense probably damaging 1.00
R4087:Zfp281 UTSW 1 136,553,859 (GRCm39) missense probably damaging 1.00
R4088:Zfp281 UTSW 1 136,553,859 (GRCm39) missense probably damaging 1.00
R4090:Zfp281 UTSW 1 136,553,859 (GRCm39) missense probably damaging 1.00
R4819:Zfp281 UTSW 1 136,553,448 (GRCm39) missense probably benign
R5380:Zfp281 UTSW 1 136,553,676 (GRCm39) missense possibly damaging 0.93
R6033:Zfp281 UTSW 1 136,554,464 (GRCm39) missense probably benign 0.14
R6033:Zfp281 UTSW 1 136,554,464 (GRCm39) missense probably benign 0.14
R6056:Zfp281 UTSW 1 136,553,178 (GRCm39) missense possibly damaging 0.93
R6213:Zfp281 UTSW 1 136,553,250 (GRCm39) missense probably benign 0.01
R7402:Zfp281 UTSW 1 136,553,190 (GRCm39) missense probably damaging 0.99
R7503:Zfp281 UTSW 1 136,554,678 (GRCm39) missense possibly damaging 0.67
R8343:Zfp281 UTSW 1 136,555,620 (GRCm39) missense probably damaging 1.00
R8722:Zfp281 UTSW 1 136,553,334 (GRCm39) missense probably benign 0.00
R9199:Zfp281 UTSW 1 136,553,643 (GRCm39) missense probably benign
R9461:Zfp281 UTSW 1 136,554,500 (GRCm39) missense probably benign 0.28
R9487:Zfp281 UTSW 1 136,555,143 (GRCm39) missense probably damaging 0.96
R9532:Zfp281 UTSW 1 136,554,894 (GRCm39) missense probably benign
R9541:Zfp281 UTSW 1 136,555,303 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCACCACCGCGATGTATTAC -3'
(R):5'- TTCATGCTGCACTGATCGC -3'

Sequencing Primer
(F):5'- ACCGCGATGTATTACTGAGC -3'
(R):5'- CCAAAGGGTTTCTCTCTGCTGTG -3'
Posted On 2020-09-15