Incidental Mutation 'R7969:Tgm5'
ID650492
Institutional Source Beutler Lab
Gene Symbol Tgm5
Ensembl Gene ENSMUSG00000053675
Gene Nametransglutaminase 5
Synonyms2310007C07Rik, TGx
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.172) question?
Stock #R7969 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location121046111-121085841 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 121075169 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 168 (N168K)
Ref Sequence ENSEMBL: ENSMUSP00000028721 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028721]
Predicted Effect probably damaging
Transcript: ENSMUST00000028721
AA Change: N168K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000028721
Gene: ENSMUSG00000053675
AA Change: N168K

DomainStartEndE-ValueType
Pfam:Transglut_N 11 127 1.4e-31 PFAM
TGc 275 368 1.86e-49 SMART
Pfam:Transglut_C 511 610 2.5e-23 PFAM
Pfam:Transglut_C 624 722 1.8e-27 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the transglutaminase family. The encoded protein catalyzes formation of protein cross-links between glutamine and lysine residues, often resulting in stabilization of protein assemblies. This reaction is calcium dependent. Mutations in this gene have been associated with acral peeling skin syndrome. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a null allele display normal skin barrier function and no signs of skin peeling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A T 13: 81,440,225 V4414E possibly damaging Het
Ahcyl2 T A 6: 29,870,664 I193N probably damaging Het
Amotl2 C T 9: 102,723,769 T345I probably benign Het
Atf6b A T 17: 34,648,575 probably null Het
Cacna1s T G 1: 136,076,732 F337C probably damaging Het
Cep85l T C 10: 53,298,184 I488V probably damaging Het
Cmas T A 6: 142,775,166 D375E probably damaging Het
Cnga4 T C 7: 105,406,046 F279S probably damaging Het
Cyp4f37 T C 17: 32,625,207 V95A probably benign Het
Dao AGG AG 5: 114,015,209 probably benign Het
Dlg2 T C 7: 92,417,258 F235S probably benign Het
Dmxl2 T C 9: 54,446,881 D427G possibly damaging Het
Efl1 T C 7: 82,692,970 Y529H probably benign Het
Epx C T 11: 87,872,721 M224I probably benign Het
Fetub A G 16: 22,929,699 R101G possibly damaging Het
Fubp1 T A 3: 152,222,246 probably null Het
Impdh2 C T 9: 108,562,306 R153* probably null Het
Kcnj12 C T 11: 61,069,604 Q243* probably null Het
Lrrn1 T A 6: 107,567,850 V203E probably damaging Het
Meikin T C 11: 54,409,710 S338P possibly damaging Het
Myl10 A T 5: 136,700,853 probably null Het
Nt5c3b T C 11: 100,434,741 K120E possibly damaging Het
Olfr118 T A 17: 37,672,656 L211H probably damaging Het
Olfr790 T C 10: 129,501,847 L313S probably benign Het
Olfr802 G A 10: 129,681,830 T303I probably benign Het
Olfr93 T A 17: 37,151,186 N262I possibly damaging Het
Pdzd7 A G 19: 45,036,225 S452P probably benign Het
Prune2 A G 19: 17,201,670 I2982V probably damaging Het
Ptpdc1 G A 13: 48,587,101 R285C probably damaging Het
Raf1 T C 6: 115,620,288 D486G probably damaging Het
Rbm27 A T 18: 42,275,480 probably benign Het
Slit2 A G 5: 48,304,036 Y1475C possibly damaging Het
Snx14 G A 9: 88,413,560 T184M probably damaging Het
Ugt2b38 A G 5: 87,424,032 V47A probably benign Het
Ush2a A G 1: 188,826,371 H3599R probably benign Het
Veph1 T C 3: 66,215,475 E211G possibly damaging Het
Wapl T A 14: 34,730,647 H832Q probably damaging Het
Zfp281 T A 1: 136,626,034 V250D probably benign Het
Zfp36l2 A G 17: 84,185,824 S462P unknown Het
Other mutations in Tgm5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01061:Tgm5 APN 2 121071496 missense probably benign 0.01
IGL01148:Tgm5 APN 2 121046675 splice site probably null
IGL01284:Tgm5 APN 2 121052547 missense possibly damaging 0.94
IGL01370:Tgm5 APN 2 121053537 missense probably benign 0.03
IGL01545:Tgm5 APN 2 121052808 missense probably damaging 1.00
IGL01547:Tgm5 APN 2 121049202 splice site probably benign
IGL01998:Tgm5 APN 2 121052439 missense probably damaging 1.00
IGL02577:Tgm5 APN 2 121077603 missense probably benign 0.01
IGL02636:Tgm5 APN 2 121076796 missense probably damaging 0.99
PIT4283001:Tgm5 UTSW 2 121071585 missense possibly damaging 0.48
R0001:Tgm5 UTSW 2 121077646 missense probably damaging 1.00
R0013:Tgm5 UTSW 2 121076882 missense probably damaging 1.00
R0105:Tgm5 UTSW 2 121077012 missense probably damaging 1.00
R0105:Tgm5 UTSW 2 121077012 missense probably damaging 1.00
R0117:Tgm5 UTSW 2 121075102 critical splice donor site probably null
R0145:Tgm5 UTSW 2 121077581 missense possibly damaging 0.93
R0356:Tgm5 UTSW 2 121053574 missense probably damaging 1.00
R0410:Tgm5 UTSW 2 121077558 missense possibly damaging 0.46
R0519:Tgm5 UTSW 2 121048895 missense probably damaging 1.00
R1674:Tgm5 UTSW 2 121071544 missense possibly damaging 0.60
R1773:Tgm5 UTSW 2 121077650 missense possibly damaging 0.67
R1864:Tgm5 UTSW 2 121075218 missense probably damaging 1.00
R2276:Tgm5 UTSW 2 121048823 splice site probably benign
R2511:Tgm5 UTSW 2 121076948 missense possibly damaging 0.62
R4180:Tgm5 UTSW 2 121076961 missense probably benign 0.13
R4230:Tgm5 UTSW 2 121070735 missense probably damaging 1.00
R4801:Tgm5 UTSW 2 121052472 missense probably damaging 1.00
R4802:Tgm5 UTSW 2 121052472 missense probably damaging 1.00
R5840:Tgm5 UTSW 2 121085660 critical splice donor site probably null
R6033:Tgm5 UTSW 2 121070729 splice site probably null
R6033:Tgm5 UTSW 2 121070729 splice site probably null
R7064:Tgm5 UTSW 2 121053514 missense probably benign 0.04
R7102:Tgm5 UTSW 2 121046498 missense possibly damaging 0.89
R7114:Tgm5 UTSW 2 121048496 nonsense probably null
R7178:Tgm5 UTSW 2 121085768 start gained probably benign
R7748:Tgm5 UTSW 2 121052808 missense probably damaging 1.00
R8428:Tgm5 UTSW 2 121048875 missense probably benign
RF022:Tgm5 UTSW 2 121071611 missense probably damaging 1.00
V3553:Tgm5 UTSW 2 121071502 missense probably damaging 1.00
X0065:Tgm5 UTSW 2 121070839 missense probably damaging 1.00
Z1177:Tgm5 UTSW 2 121052451 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCCGAGGTGCTTCTCAAAC -3'
(R):5'- TGTTCACCACACTAGTCCAAAG -3'

Sequencing Primer
(F):5'- GAGGTGCTTCTCAAACGTGCTC -3'
(R):5'- AGCAGGGATCCTTCCTGTAC -3'
Posted On2020-09-15