Mutagenetix > Incidental Mutation

Incidental Mutation 'R7969:Tgm5'

650492

Institutional Source

Beutler Lab

Gene Symbol

Tgm5

Ensembl Gene

ENSMUSG00000053675

Gene Name

transglutaminase 5

Synonyms

2310007C07Rik, TGx

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.355) question?

Stock #

R7969 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

121046111-121085841 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 121075169 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 168 (N168K)

Ref Sequence

ENSEMBL: ENSMUSP00000028721 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028721]

AlphaFold

Q9D7I9

Predicted Effect

probably damaging
Transcript: ENSMUST00000028721
AA Change: N168K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000028721
Gene: ENSMUSG00000053675
AA Change: N168K

Domain	Start	End	E-Value	Type
Pfam:Transglut_N	11	127	1.4e-31	PFAM
TGc	275	368	1.86e-49	SMART
Pfam:Transglut_C	511	610	2.5e-23	PFAM
Pfam:Transglut_C	624	722	1.8e-27	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the transglutaminase family. The encoded protein catalyzes formation of protein cross-links between glutamine and lysine residues, often resulting in stabilization of protein assemblies. This reaction is calcium dependent. Mutations in this gene have been associated with acral peeling skin syndrome. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a null allele display normal skin barrier function and no signs of skin peeling. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrv1	A	T	13: 81,440,225	V4414E	possibly damaging	Het
Ahcyl2	T	A	6: 29,870,664	I193N	probably damaging	Het
Amotl2	C	T	9: 102,723,769	T345I	probably benign	Het
Atf6b	A	T	17: 34,648,575		probably null	Het
Cacna1s	T	G	1: 136,076,732	F337C	probably damaging	Het
Cep85l	T	C	10: 53,298,184	I488V	probably damaging	Het
Cmas	T	A	6: 142,775,166	D375E	probably damaging	Het
Cnga4	T	C	7: 105,406,046	F279S	probably damaging	Het
Cyp4f37	T	C	17: 32,625,207	V95A	probably benign	Het
Dao	AGG	AG	5: 114,015,209		probably benign	Het
Dlg2	T	C	7: 92,417,258	F235S	probably benign	Het
Dmxl2	T	C	9: 54,446,881	D427G	possibly damaging	Het
Efl1	T	C	7: 82,692,970	Y529H	probably benign	Het
Epx	C	T	11: 87,872,721	M224I	probably benign	Het
Fetub	A	G	16: 22,929,699	R101G	possibly damaging	Het
Fubp1	T	A	3: 152,222,246		probably null	Het
Impdh2	C	T	9: 108,562,306	R153*	probably null	Het
Kcnj12	C	T	11: 61,069,604	Q243*	probably null	Het
Lrrn1	T	A	6: 107,567,850	V203E	probably damaging	Het
Meikin	T	C	11: 54,409,710	S338P	possibly damaging	Het
Myl10	A	T	5: 136,700,853		probably null	Het
Nt5c3b	T	C	11: 100,434,741	K120E	possibly damaging	Het
Olfr118	T	A	17: 37,672,656	L211H	probably damaging	Het
Olfr790	T	C	10: 129,501,847	L313S	probably benign	Het
Olfr802	G	A	10: 129,681,830	T303I	probably benign	Het
Olfr93	T	A	17: 37,151,186	N262I	possibly damaging	Het
Pdzd7	A	G	19: 45,036,225	S452P	probably benign	Het
Prune2	A	G	19: 17,201,670	I2982V	probably damaging	Het
Ptpdc1	G	A	13: 48,587,101	R285C	probably damaging	Het
Raf1	T	C	6: 115,620,288	D486G	probably damaging	Het
Rbm27	A	T	18: 42,275,480		probably benign	Het
Slit2	A	G	5: 48,304,036	Y1475C	possibly damaging	Het
Snx14	G	A	9: 88,413,560	T184M	probably damaging	Het
Ugt2b38	A	G	5: 87,424,032	V47A	probably benign	Het
Ush2a	A	G	1: 188,826,371	H3599R	probably benign	Het
Veph1	T	C	3: 66,215,475	E211G	possibly damaging	Het
Wapl	T	A	14: 34,730,647	H832Q	probably damaging	Het
Zfp281	T	A	1: 136,626,034	V250D	probably benign	Het
Zfp36l2	A	G	17: 84,185,824	S462P	unknown	Het

Other mutations in Tgm5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01061:Tgm5	APN	2	121071496	missense	probably benign	0.01
IGL01148:Tgm5	APN	2	121046675	splice site	probably null
IGL01284:Tgm5	APN	2	121052547	missense	possibly damaging	0.94
IGL01370:Tgm5	APN	2	121053537	missense	probably benign	0.03
IGL01545:Tgm5	APN	2	121052808	missense	probably damaging	1.00
IGL01547:Tgm5	APN	2	121049202	splice site	probably benign
IGL01998:Tgm5	APN	2	121052439	missense	probably damaging	1.00
IGL02577:Tgm5	APN	2	121077603	missense	probably benign	0.01
IGL02636:Tgm5	APN	2	121076796	missense	probably damaging	0.99
PIT4283001:Tgm5	UTSW	2	121071585	missense	possibly damaging	0.48
R0001:Tgm5	UTSW	2	121077646	missense	probably damaging	1.00
R0013:Tgm5	UTSW	2	121076882	missense	probably damaging	1.00
R0105:Tgm5	UTSW	2	121077012	missense	probably damaging	1.00
R0105:Tgm5	UTSW	2	121077012	missense	probably damaging	1.00
R0117:Tgm5	UTSW	2	121075102	critical splice donor site	probably null
R0145:Tgm5	UTSW	2	121077581	missense	possibly damaging	0.93
R0356:Tgm5	UTSW	2	121053574	missense	probably damaging	1.00
R0410:Tgm5	UTSW	2	121077558	missense	possibly damaging	0.46
R0519:Tgm5	UTSW	2	121048895	missense	probably damaging	1.00
R1674:Tgm5	UTSW	2	121071544	missense	possibly damaging	0.60
R1773:Tgm5	UTSW	2	121077650	missense	possibly damaging	0.67
R1864:Tgm5	UTSW	2	121075218	missense	probably damaging	1.00
R2276:Tgm5	UTSW	2	121048823	splice site	probably benign
R2511:Tgm5	UTSW	2	121076948	missense	possibly damaging	0.62
R4180:Tgm5	UTSW	2	121076961	missense	probably benign	0.13
R4230:Tgm5	UTSW	2	121070735	missense	probably damaging	1.00
R4801:Tgm5	UTSW	2	121052472	missense	probably damaging	1.00
R4802:Tgm5	UTSW	2	121052472	missense	probably damaging	1.00
R5840:Tgm5	UTSW	2	121085660	critical splice donor site	probably null
R6033:Tgm5	UTSW	2	121070729	splice site	probably null
R6033:Tgm5	UTSW	2	121070729	splice site	probably null
R7064:Tgm5	UTSW	2	121053514	missense	probably benign	0.04
R7102:Tgm5	UTSW	2	121046498	missense	possibly damaging	0.89
R7114:Tgm5	UTSW	2	121048496	nonsense	probably null
R7178:Tgm5	UTSW	2	121085768	start gained	probably benign
R7748:Tgm5	UTSW	2	121052808	missense	probably damaging	1.00
R8428:Tgm5	UTSW	2	121048875	missense	probably benign
R9010:Tgm5	UTSW	2	121048890	missense	possibly damaging	0.94
R9129:Tgm5	UTSW	2	121046789	missense	probably damaging	0.99
R9465:Tgm5	UTSW	2	121075152	missense	probably damaging	1.00
RF022:Tgm5	UTSW	2	121071611	missense	probably damaging	1.00
V3553:Tgm5	UTSW	2	121071502	missense	probably damaging	1.00
X0065:Tgm5	UTSW	2	121070839	missense	probably damaging	1.00
Z1177:Tgm5	UTSW	2	121052451	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACCCGAGGTGCTTCTCAAAC -3'
(R):5'- TGTTCACCACACTAGTCCAAAG -3'

Sequencing Primer
(F):5'- GAGGTGCTTCTCAAACGTGCTC -3'
(R):5'- AGCAGGGATCCTTCCTGTAC -3'

Posted On

2020-09-15