Mutagenetix > Incidental Mutation

Incidental Mutation 'R7969:Ugt2b38'

650496

Institutional Source

Beutler Lab

Gene Symbol

Ugt2b38

Ensembl Gene

ENSMUSG00000061906

Gene Name

UDP glucuronosyltransferase 2 family, polypeptide B38

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.070) question?

Stock #

R7969 (G1)

Quality Score

133.008

Status

Not validated

Chromosome

Chromosomal Location

87409942-87424203 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 87424032 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 47 (V47A)

Ref Sequence

ENSEMBL: ENSMUSP00000072598 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000072818]

AlphaFold

Q91WH2

Predicted Effect

probably benign
Transcript: ENSMUST00000072818
AA Change: V47A

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000072598
Gene: ENSMUSG00000061906
AA Change: V47A

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Pfam:UDPGT	24	527	4.1e-255	PFAM
Pfam:Glyco_tran_28_C	330	444	1.2e-7	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrv1	A	T	13: 81,440,225	V4414E	possibly damaging	Het
Ahcyl2	T	A	6: 29,870,664	I193N	probably damaging	Het
Amotl2	C	T	9: 102,723,769	T345I	probably benign	Het
Atf6b	A	T	17: 34,648,575		probably null	Het
Cacna1s	T	G	1: 136,076,732	F337C	probably damaging	Het
Cep85l	T	C	10: 53,298,184	I488V	probably damaging	Het
Cmas	T	A	6: 142,775,166	D375E	probably damaging	Het
Cnga4	T	C	7: 105,406,046	F279S	probably damaging	Het
Cyp4f37	T	C	17: 32,625,207	V95A	probably benign	Het
Dao	AGG	AG	5: 114,015,209		probably benign	Het
Dlg2	T	C	7: 92,417,258	F235S	probably benign	Het
Dmxl2	T	C	9: 54,446,881	D427G	possibly damaging	Het
Efl1	T	C	7: 82,692,970	Y529H	probably benign	Het
Epx	C	T	11: 87,872,721	M224I	probably benign	Het
Fetub	A	G	16: 22,929,699	R101G	possibly damaging	Het
Fubp1	T	A	3: 152,222,246		probably null	Het
Impdh2	C	T	9: 108,562,306	R153*	probably null	Het
Kcnj12	C	T	11: 61,069,604	Q243*	probably null	Het
Lrrn1	T	A	6: 107,567,850	V203E	probably damaging	Het
Meikin	T	C	11: 54,409,710	S338P	possibly damaging	Het
Myl10	A	T	5: 136,700,853		probably null	Het
Nt5c3b	T	C	11: 100,434,741	K120E	possibly damaging	Het
Olfr118	T	A	17: 37,672,656	L211H	probably damaging	Het
Olfr790	T	C	10: 129,501,847	L313S	probably benign	Het
Olfr802	G	A	10: 129,681,830	T303I	probably benign	Het
Olfr93	T	A	17: 37,151,186	N262I	possibly damaging	Het
Pdzd7	A	G	19: 45,036,225	S452P	probably benign	Het
Prune2	A	G	19: 17,201,670	I2982V	probably damaging	Het
Ptpdc1	G	A	13: 48,587,101	R285C	probably damaging	Het
Raf1	T	C	6: 115,620,288	D486G	probably damaging	Het
Rbm27	A	T	18: 42,275,480		probably benign	Het
Slit2	A	G	5: 48,304,036	Y1475C	possibly damaging	Het
Snx14	G	A	9: 88,413,560	T184M	probably damaging	Het
Tgm5	G	T	2: 121,075,169	N168K	probably damaging	Het
Ush2a	A	G	1: 188,826,371	H3599R	probably benign	Het
Veph1	T	C	3: 66,215,475	E211G	possibly damaging	Het
Wapl	T	A	14: 34,730,647	H832Q	probably damaging	Het
Zfp281	T	A	1: 136,626,034	V250D	probably benign	Het
Zfp36l2	A	G	17: 84,185,824	S462P	unknown	Het

Other mutations in Ugt2b38

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00959:Ugt2b38	APN	5	87411823	missense	probably damaging	1.00
IGL02326:Ugt2b38	APN	5	87423733	missense	probably damaging	1.00
IGL02537:Ugt2b38	APN	5	87421731	missense	possibly damaging	0.91
IGL02543:Ugt2b38	APN	5	87423483	missense	probably benign	0.00
IGL02852:Ugt2b38	APN	5	87411741	missense	probably benign
IGL03008:Ugt2b38	APN	5	87412423	missense	probably benign	0.00
over_easy	UTSW	5	87423742	missense	probably benign	0.25
R0089:Ugt2b38	UTSW	5	87420558	missense	probably benign	0.00
R0647:Ugt2b38	UTSW	5	87423469	missense	probably benign	0.00
R0731:Ugt2b38	UTSW	5	87420452	missense	probably damaging	1.00
R0837:Ugt2b38	UTSW	5	87411773	missense	probably damaging	1.00
R0966:Ugt2b38	UTSW	5	87412373	missense	probably damaging	1.00
R0969:Ugt2b38	UTSW	5	87412373	missense	probably damaging	1.00
R0970:Ugt2b38	UTSW	5	87412373	missense	probably damaging	1.00
R0971:Ugt2b38	UTSW	5	87412373	missense	probably damaging	1.00
R1068:Ugt2b38	UTSW	5	87412373	missense	probably damaging	1.00
R1070:Ugt2b38	UTSW	5	87412373	missense	probably damaging	1.00
R1071:Ugt2b38	UTSW	5	87412373	missense	probably damaging	1.00
R1073:Ugt2b38	UTSW	5	87412373	missense	probably damaging	1.00
R1133:Ugt2b38	UTSW	5	87412373	missense	probably damaging	1.00
R1134:Ugt2b38	UTSW	5	87412373	missense	probably damaging	1.00
R1367:Ugt2b38	UTSW	5	87424114	missense	probably benign	0.11
R1383:Ugt2b38	UTSW	5	87412373	missense	probably damaging	1.00
R1467:Ugt2b38	UTSW	5	87412373	missense	probably damaging	1.00
R1467:Ugt2b38	UTSW	5	87412373	missense	probably damaging	1.00
R1565:Ugt2b38	UTSW	5	87411914	missense	probably damaging	0.99
R1691:Ugt2b38	UTSW	5	87424132	missense	probably benign
R1725:Ugt2b38	UTSW	5	87411871	missense	probably damaging	1.00
R1736:Ugt2b38	UTSW	5	87423633	missense	probably benign
R2230:Ugt2b38	UTSW	5	87421668	missense	probably benign	0.05
R2419:Ugt2b38	UTSW	5	87423732	missense	probably damaging	1.00
R2496:Ugt2b38	UTSW	5	87421692	missense	probably damaging	1.00
R3196:Ugt2b38	UTSW	5	87410219	missense	probably damaging	0.96
R3773:Ugt2b38	UTSW	5	87424095	missense	probably damaging	0.99
R5125:Ugt2b38	UTSW	5	87411812	missense	probably damaging	1.00
R5224:Ugt2b38	UTSW	5	87423742	missense	probably benign	0.25
R5516:Ugt2b38	UTSW	5	87411843	missense	probably damaging	1.00
R5765:Ugt2b38	UTSW	5	87424095	missense	probably damaging	0.99
R6352:Ugt2b38	UTSW	5	87424001	missense	possibly damaging	0.73
R7166:Ugt2b38	UTSW	5	87410446	missense	probably damaging	1.00
R7210:Ugt2b38	UTSW	5	87410425	missense	probably damaging	0.99
R7291:Ugt2b38	UTSW	5	87411895	missense	probably damaging	1.00
R7483:Ugt2b38	UTSW	5	87424114	missense	probably damaging	0.96
R8118:Ugt2b38	UTSW	5	87423771	missense	probably damaging	1.00
R8239:Ugt2b38	UTSW	5	87423800	missense	probably benign	0.02
R8676:Ugt2b38	UTSW	5	87411822	missense	probably benign	0.12
R9178:Ugt2b38	UTSW	5	87420537	missense	probably damaging	1.00
R9193:Ugt2b38	UTSW	5	87423870	missense	probably benign	0.05
R9566:Ugt2b38	UTSW	5	87410350	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATCCCTTGGCATTTCATAAGTCCAC -3'
(R):5'- TTTAACCTCTGGGCTGAAGCTTC -3'

Sequencing Primer
(F):5'- TGGCATTTCATAAGTCCACACATC -3'
(R):5'- GCTGAAGCTTCTTGGATAAAAGGTC -3'

Posted On

2020-09-15