Mutagenetix > Incidental Mutation

Incidental Mutation 'R7969:Lrrn1'

650500

Institutional Source

Beutler Lab

Gene Symbol

Lrrn1

Ensembl Gene

ENSMUSG00000034648

Gene Name

leucine rich repeat protein 1, neuronal

Synonyms

2810047E21Rik, NLRR-1

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.340) question?

Stock #

R7969 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

107529768-107570214 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 107567850 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 203 (V203E)

Ref Sequence

ENSEMBL: ENSMUSP00000037096 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049285]

AlphaFold

Q61809

Predicted Effect

probably damaging
Transcript: ENSMUST00000049285
AA Change: V203E

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000037096
Gene: ENSMUSG00000034648
AA Change: V203E

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
LRRNT	31	76	2.89e-1	SMART
LRR	94	117	1.06e1	SMART
LRR	118	141	1.89e-1	SMART
LRR_TYP	142	165	4.3e-5	SMART
LRR	166	189	1.76e-1	SMART
LRR	214	237	4.09e1	SMART
LRR	238	261	1.53e1	SMART
LRR	262	285	2.63e0	SMART
LRR	311	335	1.45e2	SMART
LRR	336	359	4.21e1	SMART
LRRCT	371	423	2.14e-10	SMART
IGc2	438	506	6.34e-15	SMART
FN3	523	605	8.71e-2	SMART
transmembrane domain	631	653	N/A	INTRINSIC
low complexity region	690	701	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygous null mutant mice exhibited decreased exploratory activity and the female mutants exhibited an increased anxiety-like response during open field testing. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrv1	A	T	13: 81,440,225	V4414E	possibly damaging	Het
Ahcyl2	T	A	6: 29,870,664	I193N	probably damaging	Het
Amotl2	C	T	9: 102,723,769	T345I	probably benign	Het
Atf6b	A	T	17: 34,648,575		probably null	Het
Cacna1s	T	G	1: 136,076,732	F337C	probably damaging	Het
Cep85l	T	C	10: 53,298,184	I488V	probably damaging	Het
Cmas	T	A	6: 142,775,166	D375E	probably damaging	Het
Cnga4	T	C	7: 105,406,046	F279S	probably damaging	Het
Cyp4f37	T	C	17: 32,625,207	V95A	probably benign	Het
Dao	AGG	AG	5: 114,015,209		probably benign	Het
Dlg2	T	C	7: 92,417,258	F235S	probably benign	Het
Dmxl2	T	C	9: 54,446,881	D427G	possibly damaging	Het
Efl1	T	C	7: 82,692,970	Y529H	probably benign	Het
Epx	C	T	11: 87,872,721	M224I	probably benign	Het
Fetub	A	G	16: 22,929,699	R101G	possibly damaging	Het
Fubp1	T	A	3: 152,222,246		probably null	Het
Impdh2	C	T	9: 108,562,306	R153*	probably null	Het
Kcnj12	C	T	11: 61,069,604	Q243*	probably null	Het
Meikin	T	C	11: 54,409,710	S338P	possibly damaging	Het
Myl10	A	T	5: 136,700,853		probably null	Het
Nt5c3b	T	C	11: 100,434,741	K120E	possibly damaging	Het
Olfr118	T	A	17: 37,672,656	L211H	probably damaging	Het
Olfr790	T	C	10: 129,501,847	L313S	probably benign	Het
Olfr802	G	A	10: 129,681,830	T303I	probably benign	Het
Olfr93	T	A	17: 37,151,186	N262I	possibly damaging	Het
Pdzd7	A	G	19: 45,036,225	S452P	probably benign	Het
Prune2	A	G	19: 17,201,670	I2982V	probably damaging	Het
Ptpdc1	G	A	13: 48,587,101	R285C	probably damaging	Het
Raf1	T	C	6: 115,620,288	D486G	probably damaging	Het
Rbm27	A	T	18: 42,275,480		probably benign	Het
Slit2	A	G	5: 48,304,036	Y1475C	possibly damaging	Het
Snx14	G	A	9: 88,413,560	T184M	probably damaging	Het
Tgm5	G	T	2: 121,075,169	N168K	probably damaging	Het
Ugt2b38	A	G	5: 87,424,032	V47A	probably benign	Het
Ush2a	A	G	1: 188,826,371	H3599R	probably benign	Het
Veph1	T	C	3: 66,215,475	E211G	possibly damaging	Het
Wapl	T	A	14: 34,730,647	H832Q	probably damaging	Het
Zfp281	T	A	1: 136,626,034	V250D	probably benign	Het
Zfp36l2	A	G	17: 84,185,824	S462P	unknown	Het

Other mutations in Lrrn1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00834:Lrrn1	APN	6	107568308	missense	probably benign	0.06
IGL00949:Lrrn1	APN	6	107569300	missense	probably benign	0.15
IGL01594:Lrrn1	APN	6	107567493	missense	probably damaging	0.99
IGL02814:Lrrn1	APN	6	107567352	missense	probably damaging	1.00
IGL02824:Lrrn1	APN	6	107568534	missense	possibly damaging	0.57
IGL02931:Lrrn1	APN	6	107567748	missense	probably damaging	1.00
R0399:Lrrn1	UTSW	6	107569120	missense	probably benign
R1109:Lrrn1	UTSW	6	107567264	missense	probably benign
R1620:Lrrn1	UTSW	6	107568366	missense	probably damaging	1.00
R1826:Lrrn1	UTSW	6	107567568	missense	probably benign	0.05
R1893:Lrrn1	UTSW	6	107568122	missense	possibly damaging	0.82
R2327:Lrrn1	UTSW	6	107568833	missense	probably benign	0.05
R3684:Lrrn1	UTSW	6	107567949	missense	probably benign	0.13
R3757:Lrrn1	UTSW	6	107569208	missense	possibly damaging	0.81
R4538:Lrrn1	UTSW	6	107568637	missense	probably benign	0.21
R4922:Lrrn1	UTSW	6	107568350	missense	probably damaging	1.00
R4946:Lrrn1	UTSW	6	107568890	missense	probably benign	0.16
R4970:Lrrn1	UTSW	6	107569344	missense	probably benign	0.06
R4977:Lrrn1	UTSW	6	107568707	missense	probably benign
R5121:Lrrn1	UTSW	6	107569207	missense	possibly damaging	0.89
R5186:Lrrn1	UTSW	6	107569224	missense	probably damaging	1.00
R5625:Lrrn1	UTSW	6	107567354	missense	probably damaging	0.99
R5736:Lrrn1	UTSW	6	107567384	missense	probably damaging	1.00
R5873:Lrrn1	UTSW	6	107568975	missense	probably damaging	0.98
R5949:Lrrn1	UTSW	6	107567504	missense	probably benign	0.00
R6046:Lrrn1	UTSW	6	107568527	missense	probably benign	0.00
R6370:Lrrn1	UTSW	6	107569224	missense	probably damaging	1.00
R7138:Lrrn1	UTSW	6	107568375	missense	probably damaging	1.00
R7169:Lrrn1	UTSW	6	107567604	missense	probably damaging	1.00
R7413:Lrrn1	UTSW	6	107569122	missense	probably benign	0.00
R7449:Lrrn1	UTSW	6	107568521	missense	possibly damaging	0.91
R8077:Lrrn1	UTSW	6	107568822	missense	probably damaging	0.99
R8288:Lrrn1	UTSW	6	107566994	start gained	probably benign
R8420:Lrrn1	UTSW	6	107569333	missense	probably benign	0.00
R8725:Lrrn1	UTSW	6	107567342	nonsense	probably null
R9007:Lrrn1	UTSW	6	107567859	missense	probably damaging	0.99
R9133:Lrrn1	UTSW	6	107567607	missense	probably damaging	1.00
R9367:Lrrn1	UTSW	6	107568132	missense	probably damaging	0.98
R9373:Lrrn1	UTSW	6	107568504	missense	possibly damaging	0.82
R9475:Lrrn1	UTSW	6	107568300	missense	probably damaging	1.00
R9513:Lrrn1	UTSW	6	107568544	missense	probably benign	0.04
R9516:Lrrn1	UTSW	6	107568544	missense	probably benign	0.04
R9549:Lrrn1	UTSW	6	107569017	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CACAACCCTGCATCTAGAGG -3'
(R):5'- CAGGGCAAGTTGAGGGACTTTG -3'

Sequencing Primer
(F):5'- GGATTACTGTCTGCAAGACCTCAG -3'
(R):5'- GCAAGTTGAGGGACTTTGATCAG -3'

Posted On

2020-09-15