Incidental Mutation 'R7969:Efl1'
ID 650503
Institutional Source Beutler Lab
Gene Symbol Efl1
Ensembl Gene ENSMUSG00000038563
Gene Name elongation factor like GTPase 1
Synonyms D7Ertd791e, 6030468D11Rik, 4932434J20Rik, Eftud1
MMRRC Submission 046012-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.878) question?
Stock # R7969 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 82297822-82427060 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 82342178 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 529 (Y529H)
Ref Sequence ENSEMBL: ENSMUSP00000046046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039881] [ENSMUST00000179489]
AlphaFold Q8C0D5
Predicted Effect probably benign
Transcript: ENSMUST00000039881
AA Change: Y529H

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000046046
Gene: ENSMUSG00000038563
AA Change: Y529H

DomainStartEndE-ValueType
Pfam:GTP_EFTU 17 365 7.4e-62 PFAM
low complexity region 435 451 N/A INTRINSIC
Pfam:EFG_II 614 687 4.3e-9 PFAM
EFG_C 986 1075 1.03e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179489
AA Change: Y529H

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000137061
Gene: ENSMUSG00000038563
AA Change: Y529H

DomainStartEndE-ValueType
Pfam:GTP_EFTU 17 364 8.7e-58 PFAM
low complexity region 435 451 N/A INTRINSIC
Pfam:GTP_EFTU_D2 504 599 1e-7 PFAM
Pfam:EFG_II 614 687 1.8e-9 PFAM
EFG_C 986 1075 1.03e-12 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit late-onset and progressive gait abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A T 13: 81,588,344 (GRCm39) V4414E possibly damaging Het
Ahcyl2 T A 6: 29,870,663 (GRCm39) I193N probably damaging Het
Amotl2 C T 9: 102,600,968 (GRCm39) T345I probably benign Het
Atf6b A T 17: 34,867,549 (GRCm39) probably null Het
Cacna1s T G 1: 136,004,470 (GRCm39) F337C probably damaging Het
Cep85l T C 10: 53,174,280 (GRCm39) I488V probably damaging Het
Cmas T A 6: 142,720,892 (GRCm39) D375E probably damaging Het
Cnga4 T C 7: 105,055,253 (GRCm39) F279S probably damaging Het
Cyp4f37 T C 17: 32,844,181 (GRCm39) V95A probably benign Het
Dao AGG AG 5: 114,153,270 (GRCm39) probably benign Het
Dlg2 T C 7: 92,066,466 (GRCm39) F235S probably benign Het
Dmxl2 T C 9: 54,354,165 (GRCm39) D427G possibly damaging Het
Epx C T 11: 87,763,547 (GRCm39) M224I probably benign Het
Fetub A G 16: 22,748,449 (GRCm39) R101G possibly damaging Het
Fubp1 T A 3: 151,927,883 (GRCm39) probably null Het
Impdh2 C T 9: 108,439,505 (GRCm39) R153* probably null Het
Kcnj12 C T 11: 60,960,430 (GRCm39) Q243* probably null Het
Lrrn1 T A 6: 107,544,811 (GRCm39) V203E probably damaging Het
Meikin T C 11: 54,300,536 (GRCm39) S338P possibly damaging Het
Myl10 A T 5: 136,729,707 (GRCm39) probably null Het
Nt5c3b T C 11: 100,325,567 (GRCm39) K120E possibly damaging Het
Or10al2 T A 17: 37,983,547 (GRCm39) L211H probably damaging Het
Or2h1b T A 17: 37,462,077 (GRCm39) N262I possibly damaging Het
Or6c1 G A 10: 129,517,699 (GRCm39) T303I probably benign Het
Or6c75 T C 10: 129,337,716 (GRCm39) L313S probably benign Het
Pdzd7 A G 19: 45,024,664 (GRCm39) S452P probably benign Het
Prune2 A G 19: 17,179,034 (GRCm39) I2982V probably damaging Het
Ptpdc1 G A 13: 48,740,577 (GRCm39) R285C probably damaging Het
Raf1 T C 6: 115,597,249 (GRCm39) D486G probably damaging Het
Rbm27 A T 18: 42,408,545 (GRCm39) probably benign Het
Slit2 A G 5: 48,461,378 (GRCm39) Y1475C possibly damaging Het
Snx14 G A 9: 88,295,613 (GRCm39) T184M probably damaging Het
Tgm5 G T 2: 120,905,650 (GRCm39) N168K probably damaging Het
Ugt2b38 A G 5: 87,571,891 (GRCm39) V47A probably benign Het
Ush2a A G 1: 188,558,568 (GRCm39) H3599R probably benign Het
Veph1 T C 3: 66,122,896 (GRCm39) E211G possibly damaging Het
Wapl T A 14: 34,452,604 (GRCm39) H832Q probably damaging Het
Zfp281 T A 1: 136,553,772 (GRCm39) V250D probably benign Het
Zfp36l2 A G 17: 84,493,252 (GRCm39) S462P unknown Het
Other mutations in Efl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00541:Efl1 APN 7 82,307,319 (GRCm39) missense probably damaging 1.00
IGL00696:Efl1 APN 7 82,301,080 (GRCm39) splice site probably benign
IGL01344:Efl1 APN 7 82,330,688 (GRCm39) splice site probably benign
IGL01871:Efl1 APN 7 82,412,527 (GRCm39) missense possibly damaging 0.64
IGL01941:Efl1 APN 7 82,347,184 (GRCm39) missense probably benign 0.17
IGL02104:Efl1 APN 7 82,307,263 (GRCm39) critical splice acceptor site probably null
IGL02150:Efl1 APN 7 82,335,899 (GRCm39) missense probably benign
IGL02484:Efl1 APN 7 82,332,247 (GRCm39) missense probably damaging 0.98
IGL03140:Efl1 APN 7 82,342,089 (GRCm39) missense probably benign 0.00
IGL03188:Efl1 APN 7 82,320,909 (GRCm39) missense probably damaging 1.00
IGL03014:Efl1 UTSW 7 82,301,094 (GRCm39) missense probably damaging 1.00
PIT4469001:Efl1 UTSW 7 82,307,373 (GRCm39) missense probably benign 0.14
R0148:Efl1 UTSW 7 82,320,878 (GRCm39) missense probably damaging 1.00
R0226:Efl1 UTSW 7 82,342,219 (GRCm39) splice site probably benign
R0638:Efl1 UTSW 7 82,301,095 (GRCm39) missense probably damaging 1.00
R0684:Efl1 UTSW 7 82,301,094 (GRCm39) missense probably damaging 1.00
R1018:Efl1 UTSW 7 82,412,221 (GRCm39) missense possibly damaging 0.94
R1290:Efl1 UTSW 7 82,320,936 (GRCm39) missense probably damaging 1.00
R1720:Efl1 UTSW 7 82,332,929 (GRCm39) missense possibly damaging 0.50
R1933:Efl1 UTSW 7 82,412,325 (GRCm39) nonsense probably null
R1973:Efl1 UTSW 7 82,412,085 (GRCm39) missense probably damaging 1.00
R2016:Efl1 UTSW 7 82,402,917 (GRCm39) missense probably damaging 1.00
R2124:Efl1 UTSW 7 82,342,121 (GRCm39) missense probably damaging 1.00
R2290:Efl1 UTSW 7 82,426,878 (GRCm39) missense probably damaging 1.00
R2415:Efl1 UTSW 7 82,347,175 (GRCm39) missense probably damaging 1.00
R3545:Efl1 UTSW 7 82,412,018 (GRCm39) missense probably benign 0.00
R3688:Efl1 UTSW 7 82,412,178 (GRCm39) missense probably benign 0.00
R4092:Efl1 UTSW 7 82,412,035 (GRCm39) missense probably benign 0.00
R4207:Efl1 UTSW 7 82,400,024 (GRCm39) missense probably damaging 0.98
R4347:Efl1 UTSW 7 82,347,174 (GRCm39) missense probably damaging 1.00
R4425:Efl1 UTSW 7 82,412,491 (GRCm39) missense probably damaging 0.99
R4816:Efl1 UTSW 7 82,320,927 (GRCm39) missense probably damaging 1.00
R4858:Efl1 UTSW 7 82,320,835 (GRCm39) missense probably damaging 1.00
R5077:Efl1 UTSW 7 82,307,295 (GRCm39) missense probably damaging 1.00
R5185:Efl1 UTSW 7 82,421,707 (GRCm39) missense probably damaging 1.00
R5319:Efl1 UTSW 7 82,323,714 (GRCm39) missense probably damaging 1.00
R5771:Efl1 UTSW 7 82,341,732 (GRCm39) missense probably benign 0.26
R5857:Efl1 UTSW 7 82,412,397 (GRCm39) missense probably benign
R5956:Efl1 UTSW 7 82,301,107 (GRCm39) missense probably damaging 1.00
R6433:Efl1 UTSW 7 82,323,776 (GRCm39) missense probably damaging 1.00
R7131:Efl1 UTSW 7 82,307,272 (GRCm39) missense probably damaging 1.00
R7143:Efl1 UTSW 7 82,411,888 (GRCm39) missense probably damaging 1.00
R7312:Efl1 UTSW 7 82,330,652 (GRCm39) missense probably benign 0.10
R7409:Efl1 UTSW 7 82,347,121 (GRCm39) missense probably damaging 0.98
R7422:Efl1 UTSW 7 82,330,587 (GRCm39) missense probably damaging 1.00
R7453:Efl1 UTSW 7 82,330,675 (GRCm39) missense possibly damaging 0.76
R7504:Efl1 UTSW 7 82,332,257 (GRCm39) missense probably damaging 1.00
R7884:Efl1 UTSW 7 82,307,307 (GRCm39) missense probably damaging 1.00
R8394:Efl1 UTSW 7 82,411,986 (GRCm39) missense probably benign 0.00
R8702:Efl1 UTSW 7 82,399,998 (GRCm39) critical splice acceptor site probably null
R8924:Efl1 UTSW 7 82,412,161 (GRCm39) missense probably benign 0.03
R9463:Efl1 UTSW 7 82,426,733 (GRCm39) missense probably damaging 1.00
R9762:Efl1 UTSW 7 82,412,596 (GRCm39) missense probably benign 0.09
Z1088:Efl1 UTSW 7 82,342,058 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCATTTGTGGCACTGAATATC -3'
(R):5'- AAAGGCCAGAAAAGTTGTTCACTTG -3'

Sequencing Primer
(F):5'- ACTGAATATCTTTTTGTGCCTGGCAG -3'
(R):5'- GTTCACAAATGCTATTAAGGGAGCC -3'
Posted On 2020-09-15