Incidental Mutation 'R7969:Efl1'
ID650503
Institutional Source Beutler Lab
Gene Symbol Efl1
Ensembl Gene ENSMUSG00000038563
Gene Nameelongation factor like GPTase 1
Synonyms6030468D11Rik, 4932434J20Rik, D7Ertd791e, Eftud1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.243) question?
Stock #R7969 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location82648614-82777852 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 82692970 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 529 (Y529H)
Ref Sequence ENSEMBL: ENSMUSP00000046046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039881] [ENSMUST00000179489]
Predicted Effect probably benign
Transcript: ENSMUST00000039881
AA Change: Y529H

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000046046
Gene: ENSMUSG00000038563
AA Change: Y529H

DomainStartEndE-ValueType
Pfam:GTP_EFTU 17 365 7.4e-62 PFAM
low complexity region 435 451 N/A INTRINSIC
Pfam:EFG_II 614 687 4.3e-9 PFAM
EFG_C 986 1075 1.03e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179489
AA Change: Y529H

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000137061
Gene: ENSMUSG00000038563
AA Change: Y529H

DomainStartEndE-ValueType
Pfam:GTP_EFTU 17 364 8.7e-58 PFAM
low complexity region 435 451 N/A INTRINSIC
Pfam:GTP_EFTU_D2 504 599 1e-7 PFAM
Pfam:EFG_II 614 687 1.8e-9 PFAM
EFG_C 986 1075 1.03e-12 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit late-onset and progressive gait abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A T 13: 81,440,225 V4414E possibly damaging Het
Ahcyl2 T A 6: 29,870,664 I193N probably damaging Het
Amotl2 C T 9: 102,723,769 T345I probably benign Het
Atf6b A T 17: 34,648,575 probably null Het
Cacna1s T G 1: 136,076,732 F337C probably damaging Het
Cep85l T C 10: 53,298,184 I488V probably damaging Het
Cmas T A 6: 142,775,166 D375E probably damaging Het
Cnga4 T C 7: 105,406,046 F279S probably damaging Het
Cyp4f37 T C 17: 32,625,207 V95A probably benign Het
Dao AGG AG 5: 114,015,209 probably benign Het
Dlg2 T C 7: 92,417,258 F235S probably benign Het
Dmxl2 T C 9: 54,446,881 D427G possibly damaging Het
Epx C T 11: 87,872,721 M224I probably benign Het
Fetub A G 16: 22,929,699 R101G possibly damaging Het
Fubp1 T A 3: 152,222,246 probably null Het
Impdh2 C T 9: 108,562,306 R153* probably null Het
Kcnj12 C T 11: 61,069,604 Q243* probably null Het
Lrrn1 T A 6: 107,567,850 V203E probably damaging Het
Meikin T C 11: 54,409,710 S338P possibly damaging Het
Myl10 A T 5: 136,700,853 probably null Het
Nt5c3b T C 11: 100,434,741 K120E possibly damaging Het
Olfr118 T A 17: 37,672,656 L211H probably damaging Het
Olfr790 T C 10: 129,501,847 L313S probably benign Het
Olfr802 G A 10: 129,681,830 T303I probably benign Het
Olfr93 T A 17: 37,151,186 N262I possibly damaging Het
Pdzd7 A G 19: 45,036,225 S452P probably benign Het
Prune2 A G 19: 17,201,670 I2982V probably damaging Het
Ptpdc1 G A 13: 48,587,101 R285C probably damaging Het
Raf1 T C 6: 115,620,288 D486G probably damaging Het
Rbm27 A T 18: 42,275,480 probably benign Het
Slit2 A G 5: 48,304,036 Y1475C possibly damaging Het
Snx14 G A 9: 88,413,560 T184M probably damaging Het
Tgm5 G T 2: 121,075,169 N168K probably damaging Het
Ugt2b38 A G 5: 87,424,032 V47A probably benign Het
Ush2a A G 1: 188,826,371 H3599R probably benign Het
Veph1 T C 3: 66,215,475 E211G possibly damaging Het
Wapl T A 14: 34,730,647 H832Q probably damaging Het
Zfp281 T A 1: 136,626,034 V250D probably benign Het
Zfp36l2 A G 17: 84,185,824 S462P unknown Het
Other mutations in Efl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00541:Efl1 APN 7 82658111 missense probably damaging 1.00
IGL00696:Efl1 APN 7 82651872 splice site probably benign
IGL01344:Efl1 APN 7 82681480 splice site probably benign
IGL01871:Efl1 APN 7 82763319 missense possibly damaging 0.64
IGL01941:Efl1 APN 7 82697976 missense probably benign 0.17
IGL02104:Efl1 APN 7 82658055 critical splice acceptor site probably null
IGL02150:Efl1 APN 7 82686691 missense probably benign
IGL02484:Efl1 APN 7 82683039 missense probably damaging 0.98
IGL03140:Efl1 APN 7 82692881 missense probably benign 0.00
IGL03188:Efl1 APN 7 82671701 missense probably damaging 1.00
IGL03014:Efl1 UTSW 7 82651886 missense probably damaging 1.00
PIT4469001:Efl1 UTSW 7 82658165 missense probably benign 0.14
R0148:Efl1 UTSW 7 82671670 missense probably damaging 1.00
R0226:Efl1 UTSW 7 82693011 splice site probably benign
R0638:Efl1 UTSW 7 82651887 missense probably damaging 1.00
R0684:Efl1 UTSW 7 82651886 missense probably damaging 1.00
R1018:Efl1 UTSW 7 82763013 missense possibly damaging 0.94
R1290:Efl1 UTSW 7 82671728 missense probably damaging 1.00
R1720:Efl1 UTSW 7 82683721 missense possibly damaging 0.50
R1933:Efl1 UTSW 7 82763117 nonsense probably null
R1973:Efl1 UTSW 7 82762877 missense probably damaging 1.00
R2016:Efl1 UTSW 7 82753709 missense probably damaging 1.00
R2124:Efl1 UTSW 7 82692913 missense probably damaging 1.00
R2290:Efl1 UTSW 7 82777670 missense probably damaging 1.00
R2415:Efl1 UTSW 7 82697967 missense probably damaging 1.00
R3545:Efl1 UTSW 7 82762810 missense probably benign 0.00
R3688:Efl1 UTSW 7 82762970 missense probably benign 0.00
R4092:Efl1 UTSW 7 82762827 missense probably benign 0.00
R4207:Efl1 UTSW 7 82750816 missense probably damaging 0.98
R4347:Efl1 UTSW 7 82697966 missense probably damaging 1.00
R4425:Efl1 UTSW 7 82763283 missense probably damaging 0.99
R4816:Efl1 UTSW 7 82671719 missense probably damaging 1.00
R4858:Efl1 UTSW 7 82671627 missense probably damaging 1.00
R5077:Efl1 UTSW 7 82658087 missense probably damaging 1.00
R5185:Efl1 UTSW 7 82772499 missense probably damaging 1.00
R5319:Efl1 UTSW 7 82674506 missense probably damaging 1.00
R5771:Efl1 UTSW 7 82692524 missense probably benign 0.26
R5857:Efl1 UTSW 7 82763189 missense probably benign
R5956:Efl1 UTSW 7 82651899 missense probably damaging 1.00
R6433:Efl1 UTSW 7 82674568 missense probably damaging 1.00
R7131:Efl1 UTSW 7 82658064 missense probably damaging 1.00
R7143:Efl1 UTSW 7 82762680 missense probably damaging 1.00
R7312:Efl1 UTSW 7 82681444 missense probably benign 0.10
R7409:Efl1 UTSW 7 82697913 missense probably damaging 0.98
R7422:Efl1 UTSW 7 82681379 missense probably damaging 1.00
R7453:Efl1 UTSW 7 82681467 missense possibly damaging 0.76
R7504:Efl1 UTSW 7 82683049 missense probably damaging 1.00
R7884:Efl1 UTSW 7 82658099 missense probably damaging 1.00
R8394:Efl1 UTSW 7 82762778 missense probably benign 0.00
R8702:Efl1 UTSW 7 82750790 critical splice acceptor site probably null
R8924:Efl1 UTSW 7 82762953 missense probably benign 0.03
Z1088:Efl1 UTSW 7 82692850 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCATTTGTGGCACTGAATATC -3'
(R):5'- AAAGGCCAGAAAAGTTGTTCACTTG -3'

Sequencing Primer
(F):5'- ACTGAATATCTTTTTGTGCCTGGCAG -3'
(R):5'- GTTCACAAATGCTATTAAGGGAGCC -3'
Posted On2020-09-15