Mutagenetix > Incidental Mutation

Incidental Mutation 'R7969:Efl1'

650503

Institutional Source

Beutler Lab

Gene Symbol

Efl1

Ensembl Gene

ENSMUSG00000038563

Gene Name

elongation factor like GPTase 1

Synonyms

6030468D11Rik, 4932434J20Rik, D7Ertd791e, Eftud1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.849) question?

Stock #

R7969 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

82648614-82777852 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 82692970 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 529 (Y529H)

Ref Sequence

ENSEMBL: ENSMUSP00000046046 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039881] [ENSMUST00000179489]

AlphaFold

Q8C0D5

Predicted Effect

probably benign
Transcript: ENSMUST00000039881
AA Change: Y529H

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000046046
Gene: ENSMUSG00000038563
AA Change: Y529H

Domain	Start	End	E-Value	Type
Pfam:GTP_EFTU	17	365	7.4e-62	PFAM
low complexity region	435	451	N/A	INTRINSIC
Pfam:EFG_II	614	687	4.3e-9	PFAM
EFG_C	986	1075	1.03e-12	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000179489
AA Change: Y529H

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000137061
Gene: ENSMUSG00000038563
AA Change: Y529H

Domain	Start	End	E-Value	Type
Pfam:GTP_EFTU	17	364	8.7e-58	PFAM
low complexity region	435	451	N/A	INTRINSIC
Pfam:GTP_EFTU_D2	504	599	1e-7	PFAM
Pfam:EFG_II	614	687	1.8e-9	PFAM
EFG_C	986	1075	1.03e-12	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit late-onset and progressive gait abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrv1	A	T	13: 81,440,225	V4414E	possibly damaging	Het
Ahcyl2	T	A	6: 29,870,664	I193N	probably damaging	Het
Amotl2	C	T	9: 102,723,769	T345I	probably benign	Het
Atf6b	A	T	17: 34,648,575		probably null	Het
Cacna1s	T	G	1: 136,076,732	F337C	probably damaging	Het
Cep85l	T	C	10: 53,298,184	I488V	probably damaging	Het
Cmas	T	A	6: 142,775,166	D375E	probably damaging	Het
Cnga4	T	C	7: 105,406,046	F279S	probably damaging	Het
Cyp4f37	T	C	17: 32,625,207	V95A	probably benign	Het
Dao	AGG	AG	5: 114,015,209		probably benign	Het
Dlg2	T	C	7: 92,417,258	F235S	probably benign	Het
Dmxl2	T	C	9: 54,446,881	D427G	possibly damaging	Het
Epx	C	T	11: 87,872,721	M224I	probably benign	Het
Fetub	A	G	16: 22,929,699	R101G	possibly damaging	Het
Fubp1	T	A	3: 152,222,246		probably null	Het
Impdh2	C	T	9: 108,562,306	R153*	probably null	Het
Kcnj12	C	T	11: 61,069,604	Q243*	probably null	Het
Lrrn1	T	A	6: 107,567,850	V203E	probably damaging	Het
Meikin	T	C	11: 54,409,710	S338P	possibly damaging	Het
Myl10	A	T	5: 136,700,853		probably null	Het
Nt5c3b	T	C	11: 100,434,741	K120E	possibly damaging	Het
Olfr118	T	A	17: 37,672,656	L211H	probably damaging	Het
Olfr790	T	C	10: 129,501,847	L313S	probably benign	Het
Olfr802	G	A	10: 129,681,830	T303I	probably benign	Het
Olfr93	T	A	17: 37,151,186	N262I	possibly damaging	Het
Pdzd7	A	G	19: 45,036,225	S452P	probably benign	Het
Prune2	A	G	19: 17,201,670	I2982V	probably damaging	Het
Ptpdc1	G	A	13: 48,587,101	R285C	probably damaging	Het
Raf1	T	C	6: 115,620,288	D486G	probably damaging	Het
Rbm27	A	T	18: 42,275,480		probably benign	Het
Slit2	A	G	5: 48,304,036	Y1475C	possibly damaging	Het
Snx14	G	A	9: 88,413,560	T184M	probably damaging	Het
Tgm5	G	T	2: 121,075,169	N168K	probably damaging	Het
Ugt2b38	A	G	5: 87,424,032	V47A	probably benign	Het
Ush2a	A	G	1: 188,826,371	H3599R	probably benign	Het
Veph1	T	C	3: 66,215,475	E211G	possibly damaging	Het
Wapl	T	A	14: 34,730,647	H832Q	probably damaging	Het
Zfp281	T	A	1: 136,626,034	V250D	probably benign	Het
Zfp36l2	A	G	17: 84,185,824	S462P	unknown	Het

Other mutations in Efl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00541:Efl1	APN	7	82658111	missense	probably damaging	1.00
IGL00696:Efl1	APN	7	82651872	splice site	probably benign
IGL01344:Efl1	APN	7	82681480	splice site	probably benign
IGL01871:Efl1	APN	7	82763319	missense	possibly damaging	0.64
IGL01941:Efl1	APN	7	82697976	missense	probably benign	0.17
IGL02104:Efl1	APN	7	82658055	critical splice acceptor site	probably null
IGL02150:Efl1	APN	7	82686691	missense	probably benign
IGL02484:Efl1	APN	7	82683039	missense	probably damaging	0.98
IGL03140:Efl1	APN	7	82692881	missense	probably benign	0.00
IGL03188:Efl1	APN	7	82671701	missense	probably damaging	1.00
IGL03014:Efl1	UTSW	7	82651886	missense	probably damaging	1.00
PIT4469001:Efl1	UTSW	7	82658165	missense	probably benign	0.14
R0148:Efl1	UTSW	7	82671670	missense	probably damaging	1.00
R0226:Efl1	UTSW	7	82693011	splice site	probably benign
R0638:Efl1	UTSW	7	82651887	missense	probably damaging	1.00
R0684:Efl1	UTSW	7	82651886	missense	probably damaging	1.00
R1018:Efl1	UTSW	7	82763013	missense	possibly damaging	0.94
R1290:Efl1	UTSW	7	82671728	missense	probably damaging	1.00
R1720:Efl1	UTSW	7	82683721	missense	possibly damaging	0.50
R1933:Efl1	UTSW	7	82763117	nonsense	probably null
R1973:Efl1	UTSW	7	82762877	missense	probably damaging	1.00
R2016:Efl1	UTSW	7	82753709	missense	probably damaging	1.00
R2124:Efl1	UTSW	7	82692913	missense	probably damaging	1.00
R2290:Efl1	UTSW	7	82777670	missense	probably damaging	1.00
R2415:Efl1	UTSW	7	82697967	missense	probably damaging	1.00
R3545:Efl1	UTSW	7	82762810	missense	probably benign	0.00
R3688:Efl1	UTSW	7	82762970	missense	probably benign	0.00
R4092:Efl1	UTSW	7	82762827	missense	probably benign	0.00
R4207:Efl1	UTSW	7	82750816	missense	probably damaging	0.98
R4347:Efl1	UTSW	7	82697966	missense	probably damaging	1.00
R4425:Efl1	UTSW	7	82763283	missense	probably damaging	0.99
R4816:Efl1	UTSW	7	82671719	missense	probably damaging	1.00
R4858:Efl1	UTSW	7	82671627	missense	probably damaging	1.00
R5077:Efl1	UTSW	7	82658087	missense	probably damaging	1.00
R5185:Efl1	UTSW	7	82772499	missense	probably damaging	1.00
R5319:Efl1	UTSW	7	82674506	missense	probably damaging	1.00
R5771:Efl1	UTSW	7	82692524	missense	probably benign	0.26
R5857:Efl1	UTSW	7	82763189	missense	probably benign
R5956:Efl1	UTSW	7	82651899	missense	probably damaging	1.00
R6433:Efl1	UTSW	7	82674568	missense	probably damaging	1.00
R7131:Efl1	UTSW	7	82658064	missense	probably damaging	1.00
R7143:Efl1	UTSW	7	82762680	missense	probably damaging	1.00
R7312:Efl1	UTSW	7	82681444	missense	probably benign	0.10
R7409:Efl1	UTSW	7	82697913	missense	probably damaging	0.98
R7422:Efl1	UTSW	7	82681379	missense	probably damaging	1.00
R7453:Efl1	UTSW	7	82681467	missense	possibly damaging	0.76
R7504:Efl1	UTSW	7	82683049	missense	probably damaging	1.00
R7884:Efl1	UTSW	7	82658099	missense	probably damaging	1.00
R8394:Efl1	UTSW	7	82762778	missense	probably benign	0.00
R8702:Efl1	UTSW	7	82750790	critical splice acceptor site	probably null
R8924:Efl1	UTSW	7	82762953	missense	probably benign	0.03
R9463:Efl1	UTSW	7	82777525	missense	probably damaging	1.00
R9762:Efl1	UTSW	7	82763388	missense	probably benign	0.09
Z1088:Efl1	UTSW	7	82692850	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- AGCATTTGTGGCACTGAATATC -3'
(R):5'- AAAGGCCAGAAAAGTTGTTCACTTG -3'

Sequencing Primer
(F):5'- ACTGAATATCTTTTTGTGCCTGGCAG -3'
(R):5'- GTTCACAAATGCTATTAAGGGAGCC -3'

Posted On

2020-09-15