Incidental Mutation 'R7969:Dmxl2'
ID 650506
Institutional Source Beutler Lab
Gene Symbol Dmxl2
Ensembl Gene ENSMUSG00000041268
Gene Name Dmx-like 2
Synonyms E130119P06Rik, 6430411K14Rik
MMRRC Submission
Accession Numbers

NCBI RefSeq: NM_172771.2; MGI:2444630
Essential gene? Essential (E-score: 1.000) question?
Stock # R7969 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 54365158-54501626 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 54446881 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 427 (D427G)
Ref Sequence ENSEMBL: ENSMUSP00000122293 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118163] [ENSMUST00000118600] [ENSMUST00000127880]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000118163
AA Change: D601G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113705
Gene: ENSMUSG00000041268
AA Change: D601G

DomainStartEndE-ValueType
WD40 43 84 4.58e1 SMART
WD40 100 136 2.28e2 SMART
WD40 159 198 2.57e-2 SMART
WD40 221 269 1.03e-1 SMART
low complexity region 420 440 N/A INTRINSIC
WD40 741 793 1.42e2 SMART
low complexity region 861 875 N/A INTRINSIC
low complexity region 945 961 N/A INTRINSIC
WD40 985 1029 1.15e1 SMART
WD40 1236 1273 2.84e2 SMART
Pfam:Rav1p_C 1430 1903 1.5e-71 PFAM
low complexity region 1978 1993 N/A INTRINSIC
coiled coil region 2118 2146 N/A INTRINSIC
low complexity region 2189 2204 N/A INTRINSIC
low complexity region 2251 2266 N/A INTRINSIC
low complexity region 2472 2490 N/A INTRINSIC
low complexity region 2635 2649 N/A INTRINSIC
low complexity region 2744 2766 N/A INTRINSIC
WD40 2774 2809 5.73e0 SMART
WD40 2813 2852 8.88e0 SMART
WD40 2859 2901 2.67e-1 SMART
WD40 2907 2946 2.57e-2 SMART
WD40 2949 2988 3.61e-6 SMART
WD40 3001 3039 8.25e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000118600
AA Change: D601G

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000113693
Gene: ENSMUSG00000041268
AA Change: D601G

DomainStartEndE-ValueType
WD40 43 84 4.58e1 SMART
WD40 100 136 2.28e2 SMART
WD40 159 198 2.57e-2 SMART
WD40 221 269 1.03e-1 SMART
low complexity region 420 440 N/A INTRINSIC
WD40 741 793 1.42e2 SMART
low complexity region 861 875 N/A INTRINSIC
low complexity region 945 961 N/A INTRINSIC
WD40 985 1029 1.15e1 SMART
WD40 1236 1273 2.84e2 SMART
low complexity region 1426 1436 N/A INTRINSIC
Pfam:Rav1p_C 1447 1903 4.2e-68 PFAM
low complexity region 1978 1993 N/A INTRINSIC
coiled coil region 2118 2146 N/A INTRINSIC
low complexity region 2189 2204 N/A INTRINSIC
low complexity region 2251 2266 N/A INTRINSIC
low complexity region 2471 2489 N/A INTRINSIC
low complexity region 2722 2744 N/A INTRINSIC
WD40 2752 2787 5.73e0 SMART
WD40 2791 2830 8.88e0 SMART
WD40 2837 2879 2.67e-1 SMART
WD40 2885 2924 2.57e-2 SMART
WD40 2927 2966 3.61e-6 SMART
WD40 2979 3017 8.25e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123709
SMART Domains Protein: ENSMUSP00000119959
Gene: ENSMUSG00000041268

DomainStartEndE-ValueType
low complexity region 63 77 N/A INTRINSIC
low complexity region 147 163 N/A INTRINSIC
WD40 187 231 1.15e1 SMART
WD40 438 475 2.84e2 SMART
Pfam:Rav1p_C 632 1105 9.1e-72 PFAM
low complexity region 1180 1195 N/A INTRINSIC
coiled coil region 1319 1347 N/A INTRINSIC
low complexity region 1391 1406 N/A INTRINSIC
low complexity region 1453 1468 N/A INTRINSIC
low complexity region 1674 1692 N/A INTRINSIC
low complexity region 1925 1947 N/A INTRINSIC
WD40 1955 1990 5.73e0 SMART
WD40 1994 2033 8.88e0 SMART
WD40 2040 2082 2.67e-1 SMART
WD40 2088 2127 2.57e-2 SMART
WD40 2130 2169 3.61e-6 SMART
WD40 2182 2220 8.25e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000127880
AA Change: D427G

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000122293
Gene: ENSMUSG00000041268
AA Change: D427G

DomainStartEndE-ValueType
Pfam:WD40 1 24 7.9e-4 PFAM
WD40 47 95 1.03e-1 SMART
low complexity region 246 266 N/A INTRINSIC
WD40 567 619 1.42e2 SMART
low complexity region 687 701 N/A INTRINSIC
low complexity region 771 787 N/A INTRINSIC
WD40 811 855 1.15e1 SMART
WD40 1062 1099 2.84e2 SMART
low complexity region 1252 1262 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with 12 WD domains. Proteins with WD domains are involved in many functions including participation in signal transduction pathways. Participation of the encoded protein in regulation of the Notch signaling pathway has been demonstrated in vitro using several human cell lines (PMID:20810660). A gene encoding a similar protein is located on chromosome 5. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete prenatal lethality. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(2) Gene trapped(2)
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A T 13: 81,440,225 V4414E possibly damaging Het
Ahcyl2 T A 6: 29,870,664 I193N probably damaging Het
Amotl2 C T 9: 102,723,769 T345I probably benign Het
Atf6b A T 17: 34,648,575 probably null Het
Cacna1s T G 1: 136,076,732 F337C probably damaging Het
Cep85l T C 10: 53,298,184 I488V probably damaging Het
Cmas T A 6: 142,775,166 D375E probably damaging Het
Cnga4 T C 7: 105,406,046 F279S probably damaging Het
Cyp4f37 T C 17: 32,625,207 V95A probably benign Het
Dao AGG AG 5: 114,015,209 probably benign Het
Dlg2 T C 7: 92,417,258 F235S probably benign Het
Efl1 T C 7: 82,692,970 Y529H probably benign Het
Epx C T 11: 87,872,721 M224I probably benign Het
Fetub A G 16: 22,929,699 R101G possibly damaging Het
Fubp1 T A 3: 152,222,246 probably null Het
Impdh2 C T 9: 108,562,306 R153* probably null Het
Kcnj12 C T 11: 61,069,604 Q243* probably null Het
Lrrn1 T A 6: 107,567,850 V203E probably damaging Het
Meikin T C 11: 54,409,710 S338P possibly damaging Het
Myl10 A T 5: 136,700,853 probably null Het
Nt5c3b T C 11: 100,434,741 K120E possibly damaging Het
Olfr118 T A 17: 37,672,656 L211H probably damaging Het
Olfr790 T C 10: 129,501,847 L313S probably benign Het
Olfr802 G A 10: 129,681,830 T303I probably benign Het
Olfr93 T A 17: 37,151,186 N262I possibly damaging Het
Pdzd7 A G 19: 45,036,225 S452P probably benign Het
Prune2 A G 19: 17,201,670 I2982V probably damaging Het
Ptpdc1 G A 13: 48,587,101 R285C probably damaging Het
Raf1 T C 6: 115,620,288 D486G probably damaging Het
Rbm27 A T 18: 42,275,480 probably benign Het
Slit2 A G 5: 48,304,036 Y1475C possibly damaging Het
Snx14 G A 9: 88,413,560 T184M probably damaging Het
Tgm5 G T 2: 121,075,169 N168K probably damaging Het
Ugt2b38 A G 5: 87,424,032 V47A probably benign Het
Ush2a A G 1: 188,826,371 H3599R probably benign Het
Veph1 T C 3: 66,215,475 E211G possibly damaging Het
Wapl T A 14: 34,730,647 H832Q probably damaging Het
Zfp281 T A 1: 136,626,034 V250D probably benign Het
Zfp36l2 A G 17: 84,185,824 S462P unknown Het
Other mutations in Dmxl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Dmxl2 APN 9 54401704 missense probably benign
IGL00226:Dmxl2 APN 9 54415993 missense probably damaging 1.00
IGL00419:Dmxl2 APN 9 54406667 missense probably damaging 0.96
IGL00551:Dmxl2 APN 9 54450838 missense probably damaging 1.00
IGL00765:Dmxl2 APN 9 54415422 unclassified probably benign
IGL00852:Dmxl2 APN 9 54423313 nonsense probably null
IGL00857:Dmxl2 APN 9 54376320 missense probably benign 0.32
IGL00952:Dmxl2 APN 9 54416882 missense probably damaging 0.99
IGL01139:Dmxl2 APN 9 54458964 missense probably damaging 1.00
IGL01346:Dmxl2 APN 9 54415475 missense probably damaging 1.00
IGL01538:Dmxl2 APN 9 54445376 splice site probably benign
IGL01645:Dmxl2 APN 9 54378733 missense possibly damaging 0.93
IGL02096:Dmxl2 APN 9 54401065 missense possibly damaging 0.89
IGL02104:Dmxl2 APN 9 54404015 nonsense probably null
IGL02145:Dmxl2 APN 9 54374697 missense probably benign 0.29
IGL02210:Dmxl2 APN 9 54404049 missense probably damaging 1.00
IGL02238:Dmxl2 APN 9 54445433 missense probably damaging 1.00
IGL02255:Dmxl2 APN 9 54393768 missense probably benign 0.06
IGL02364:Dmxl2 APN 9 54393843 missense probably benign 0.02
IGL02423:Dmxl2 APN 9 54393748 missense possibly damaging 0.89
IGL02440:Dmxl2 APN 9 54406615 missense probably damaging 0.98
IGL02546:Dmxl2 APN 9 54366414 utr 3 prime probably benign
IGL02668:Dmxl2 APN 9 54416945 missense probably damaging 1.00
IGL03229:Dmxl2 APN 9 54404172 missense probably damaging 1.00
IGL03244:Dmxl2 APN 9 54416371 missense probably damaging 1.00
IGL03277:Dmxl2 APN 9 54404220 missense probably damaging 1.00
IGL03399:Dmxl2 APN 9 54446672 missense probably damaging 1.00
BB003:Dmxl2 UTSW 9 54428042 missense probably benign 0.01
BB013:Dmxl2 UTSW 9 54428042 missense probably benign 0.01
I2288:Dmxl2 UTSW 9 54401793 missense probably damaging 1.00
P0014:Dmxl2 UTSW 9 54401764 missense probably damaging 1.00
R0411:Dmxl2 UTSW 9 54378939 missense probably damaging 1.00
R0422:Dmxl2 UTSW 9 54399940 critical splice donor site probably null
R0432:Dmxl2 UTSW 9 54416951 missense probably benign 0.01
R0436:Dmxl2 UTSW 9 54383750 missense probably damaging 1.00
R0538:Dmxl2 UTSW 9 54393836 missense probably benign 0.06
R0603:Dmxl2 UTSW 9 54405906 missense possibly damaging 0.95
R0605:Dmxl2 UTSW 9 54419945 missense probably benign 0.01
R0625:Dmxl2 UTSW 9 54382702 missense probably benign
R0626:Dmxl2 UTSW 9 54416554 missense probably damaging 1.00
R0736:Dmxl2 UTSW 9 54378817 missense probably damaging 0.99
R0847:Dmxl2 UTSW 9 54405828 missense probably damaging 1.00
R0855:Dmxl2 UTSW 9 54366440 missense probably benign 0.03
R0962:Dmxl2 UTSW 9 54446412 missense probably damaging 0.99
R1015:Dmxl2 UTSW 9 54367765 missense probably benign 0.32
R1084:Dmxl2 UTSW 9 54416433 missense probably damaging 1.00
R1328:Dmxl2 UTSW 9 54396249 missense probably benign 0.12
R1401:Dmxl2 UTSW 9 54415428 critical splice donor site probably null
R1503:Dmxl2 UTSW 9 54446988 nonsense probably null
R1609:Dmxl2 UTSW 9 54409263 missense possibly damaging 0.90
R1613:Dmxl2 UTSW 9 54382027 missense probably benign
R1660:Dmxl2 UTSW 9 54451030 missense possibly damaging 0.68
R1712:Dmxl2 UTSW 9 54401485 missense probably benign 0.00
R1772:Dmxl2 UTSW 9 54423224 splice site probably benign
R1832:Dmxl2 UTSW 9 54460949 missense probably damaging 0.97
R1922:Dmxl2 UTSW 9 54401523 missense probably benign
R2104:Dmxl2 UTSW 9 54415564 missense probably damaging 1.00
R2109:Dmxl2 UTSW 9 54393813 missense probably benign 0.06
R2145:Dmxl2 UTSW 9 54415910 missense probably damaging 1.00
R2199:Dmxl2 UTSW 9 54376243 missense probably benign 0.35
R2352:Dmxl2 UTSW 9 54393862 missense probably damaging 1.00
R2516:Dmxl2 UTSW 9 54400094 missense probably damaging 1.00
R2981:Dmxl2 UTSW 9 54393702 missense probably damaging 1.00
R3430:Dmxl2 UTSW 9 54477461 missense possibly damaging 0.94
R3625:Dmxl2 UTSW 9 54393643 missense probably benign 0.23
R3725:Dmxl2 UTSW 9 54393769 missense probably damaging 1.00
R3787:Dmxl2 UTSW 9 54369878 missense probably damaging 1.00
R4002:Dmxl2 UTSW 9 54473832 splice site probably benign
R4004:Dmxl2 UTSW 9 54446390 missense probably benign 0.04
R4005:Dmxl2 UTSW 9 54446390 missense probably benign 0.04
R4012:Dmxl2 UTSW 9 54379013 splice site probably null
R4014:Dmxl2 UTSW 9 54378709 splice site probably null
R4115:Dmxl2 UTSW 9 54446988 nonsense probably null
R4232:Dmxl2 UTSW 9 54419909 missense possibly damaging 0.89
R4388:Dmxl2 UTSW 9 54396267 missense probably damaging 1.00
R4513:Dmxl2 UTSW 9 54419884 missense probably null 0.17
R4552:Dmxl2 UTSW 9 54451763 missense probably damaging 1.00
R4609:Dmxl2 UTSW 9 54446512 missense probably damaging 1.00
R4625:Dmxl2 UTSW 9 54404120 missense possibly damaging 0.55
R4694:Dmxl2 UTSW 9 54446905 missense probably benign 0.04
R4711:Dmxl2 UTSW 9 54450924 missense probably benign 0.37
R4715:Dmxl2 UTSW 9 54446405 splice site probably null
R4746:Dmxl2 UTSW 9 54451796 missense probably benign 0.04
R4789:Dmxl2 UTSW 9 54379815 missense probably benign 0.30
R4825:Dmxl2 UTSW 9 54404041 missense probably benign 0.01
R4911:Dmxl2 UTSW 9 54411653 missense probably damaging 1.00
R4995:Dmxl2 UTSW 9 54501441 utr 5 prime probably benign
R5026:Dmxl2 UTSW 9 54416676 missense probably damaging 1.00
R5118:Dmxl2 UTSW 9 54460987 missense probably damaging 1.00
R5174:Dmxl2 UTSW 9 54445484 splice site probably null
R5288:Dmxl2 UTSW 9 54378757 missense probably benign
R5373:Dmxl2 UTSW 9 54369189 intron probably benign
R5374:Dmxl2 UTSW 9 54369189 intron probably benign
R5385:Dmxl2 UTSW 9 54378757 missense probably benign
R5386:Dmxl2 UTSW 9 54378757 missense probably benign
R5418:Dmxl2 UTSW 9 54374651 critical splice donor site probably null
R5540:Dmxl2 UTSW 9 54393857 missense probably benign 0.21
R5568:Dmxl2 UTSW 9 54423359 splice site probably null
R5733:Dmxl2 UTSW 9 54376266 missense possibly damaging 0.64
R5758:Dmxl2 UTSW 9 54472964 missense probably benign 0.28
R5759:Dmxl2 UTSW 9 54375508 missense probably damaging 1.00
R5893:Dmxl2 UTSW 9 54387420 missense possibly damaging 0.64
R6030:Dmxl2 UTSW 9 54393673 missense probably benign 0.18
R6030:Dmxl2 UTSW 9 54393673 missense probably benign 0.18
R6041:Dmxl2 UTSW 9 54416753 missense probably damaging 1.00
R6174:Dmxl2 UTSW 9 54393727 missense probably damaging 1.00
R6278:Dmxl2 UTSW 9 54415762 missense probably damaging 1.00
R6307:Dmxl2 UTSW 9 54382706 missense possibly damaging 0.68
R6349:Dmxl2 UTSW 9 54419909 missense possibly damaging 0.89
R6404:Dmxl2 UTSW 9 54375536 missense probably damaging 1.00
R6516:Dmxl2 UTSW 9 54416676 missense probably damaging 1.00
R6712:Dmxl2 UTSW 9 54411624 missense probably damaging 1.00
R6747:Dmxl2 UTSW 9 54416088 missense probably damaging 1.00
R6769:Dmxl2 UTSW 9 54416524 missense probably damaging 1.00
R6771:Dmxl2 UTSW 9 54416524 missense probably damaging 1.00
R6800:Dmxl2 UTSW 9 54409183 missense probably damaging 1.00
R6891:Dmxl2 UTSW 9 54480380 missense probably damaging 0.99
R6920:Dmxl2 UTSW 9 54472212 missense probably damaging 1.00
R6979:Dmxl2 UTSW 9 54450879 missense possibly damaging 0.49
R7147:Dmxl2 UTSW 9 54416729 missense probably benign 0.06
R7327:Dmxl2 UTSW 9 54401585 missense probably damaging 1.00
R7462:Dmxl2 UTSW 9 54366632 splice site probably null
R7526:Dmxl2 UTSW 9 54400957 missense possibly damaging 0.47
R7569:Dmxl2 UTSW 9 54415987 missense possibly damaging 0.51
R7622:Dmxl2 UTSW 9 54472218 missense probably damaging 0.99
R7638:Dmxl2 UTSW 9 54457794 missense unknown
R7703:Dmxl2 UTSW 9 54461086 missense probably benign 0.01
R7768:Dmxl2 UTSW 9 54380939 missense probably damaging 1.00
R7926:Dmxl2 UTSW 9 54428042 missense probably benign 0.01
R8007:Dmxl2 UTSW 9 54383691 nonsense probably null
R8200:Dmxl2 UTSW 9 54480346 missense probably benign
R8311:Dmxl2 UTSW 9 54446933 missense probably benign 0.00
R8320:Dmxl2 UTSW 9 54383759 missense probably benign
R8377:Dmxl2 UTSW 9 54378748 missense probably damaging 1.00
R8400:Dmxl2 UTSW 9 54383753 missense probably benign 0.03
R8509:Dmxl2 UTSW 9 54428057 nonsense probably null
R8698:Dmxl2 UTSW 9 54374669 missense probably benign 0.10
R8768:Dmxl2 UTSW 9 54393821 missense possibly damaging 0.83
R8770:Dmxl2 UTSW 9 54404014 missense probably benign 0.01
R8799:Dmxl2 UTSW 9 54419743 critical splice donor site probably null
R8840:Dmxl2 UTSW 9 54401855 missense possibly damaging 0.58
R8898:Dmxl2 UTSW 9 54401657 missense probably benign 0.01
R8954:Dmxl2 UTSW 9 54473872 missense probably benign 0.04
R9083:Dmxl2 UTSW 9 54409264 missense probably benign 0.29
R9114:Dmxl2 UTSW 9 54400037 missense
R9115:Dmxl2 UTSW 9 54401727 missense probably benign
R9263:Dmxl2 UTSW 9 54451661 missense probably benign 0.01
R9272:Dmxl2 UTSW 9 54404120 missense possibly damaging 0.55
R9577:Dmxl2 UTSW 9 54416380 missense unknown
R9673:Dmxl2 UTSW 9 54387556 missense probably damaging 1.00
R9722:Dmxl2 UTSW 9 54416608 missense probably benign 0.00
R9726:Dmxl2 UTSW 9 54415712 missense probably benign 0.09
R9797:Dmxl2 UTSW 9 54450903 missense probably benign 0.00
X0064:Dmxl2 UTSW 9 54401713 missense probably benign
Z1177:Dmxl2 UTSW 9 54382034 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CATGCCAGGTCATTGAGGTG -3'
(R):5'- CTAGGAGGCTAGGATTTGGC -3'

Sequencing Primer
(F):5'- TGGAATCGGTGACCACAGTATCTG -3'
(R):5'- CTTTTTGAAAGAAGGCAAACTCC -3'
Posted On 2020-09-15