Mutagenetix > Incidental Mutation

Incidental Mutation 'R7969:Snx14'

650507

Institutional Source

Beutler Lab

Gene Symbol

Snx14

Ensembl Gene

ENSMUSG00000032422

Gene Name

sorting nexin 14

Synonyms

C330035N22Rik, YR-14

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7969 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

88376750-88438958 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 88413560 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Methionine at position 184 (T184M)

Ref Sequence

ENSEMBL: ENSMUSP00000130116 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000126405] [ENSMUST00000165315] [ENSMUST00000173011] [ENSMUST00000173039] [ENSMUST00000174806]

AlphaFold

Q8BHY8

Predicted Effect

probably damaging
Transcript: ENSMUST00000126405
AA Change: T184M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000116773
Gene: ENSMUSG00000032422
AA Change: T184M

Domain	Start	End	E-Value	Type
transmembrane domain	57	76	N/A	INTRINSIC
transmembrane domain	80	102	N/A	INTRINSIC
Pfam:PXA	157	210	3.9e-13	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000165315
AA Change: T184M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000130116
Gene: ENSMUSG00000032422
AA Change: T184M

Domain	Start	End	E-Value	Type
transmembrane domain	54	73	N/A	INTRINSIC
transmembrane domain	75	97	N/A	INTRINSIC
Pfam:PXA	157	330	8.2e-49	PFAM
Pfam:RGS	363	495	4.3e-13	PFAM
PX	585	704	8.77e-13	SMART
low complexity region	771	785	N/A	INTRINSIC
Pfam:Nexin_C	825	930	2e-28	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000173011
AA Change: T184M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000133507
Gene: ENSMUSG00000032422
AA Change: T184M

Domain	Start	End	E-Value	Type
transmembrane domain	54	73	N/A	INTRINSIC
transmembrane domain	75	97	N/A	INTRINSIC
Pfam:PXA	157	330	3.1e-49	PFAM
Pfam:RGS	363	482	3.1e-9	PFAM
low complexity region	499	513	N/A	INTRINSIC
Pfam:Nexin_C	553	658	7.2e-29	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000173039

SMART Domains

Protein: ENSMUSP00000133624
Gene: ENSMUSG00000032422

Domain	Start	End	E-Value	Type
transmembrane domain	54	73	N/A	INTRINSIC
transmembrane domain	75	97	N/A	INTRINSIC
Pfam:PXA	154	286	6.5e-33	PFAM
Pfam:RGS	319	451	2.6e-13	PFAM
PX	541	660	8.77e-13	SMART
low complexity region	727	741	N/A	INTRINSIC
Pfam:Nexin_C	781	886	1.1e-28	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000173131

SMART Domains

Protein: ENSMUSP00000134122
Gene: ENSMUSG00000092541

Domain	Start	End	E-Value	Type
low complexity region	1	26	N/A	INTRINSIC
low complexity region	30	58	N/A	INTRINSIC
low complexity region	62	88	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000174806
AA Change: T184M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000133533
Gene: ENSMUSG00000032422
AA Change: T184M

Domain	Start	End	E-Value	Type
transmembrane domain	54	73	N/A	INTRINSIC
transmembrane domain	75	97	N/A	INTRINSIC
Pfam:PXA	158	327	1.9e-44	PFAM
Pfam:RGS	363	495	1.3e-13	PFAM
PX	594	713	8.77e-13	SMART
low complexity region	780	794	N/A	INTRINSIC
Pfam:Nexin_C	834	938	2.8e-18	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sorting nexin family. Members of this family have a phox (PX) phosphoinositide binding domain and are involved in intracellular trafficking. The encoded protein also contains a regulator of G protein signaling (RGS) domain. Regulator of G protein signaling family members are regulatory molecules that act as GTPase activating proteins for G alpha subunits of heterotrimeric G proteins. Alternate splicing results in transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2014]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrv1	A	T	13: 81,440,225	V4414E	possibly damaging	Het
Ahcyl2	T	A	6: 29,870,664	I193N	probably damaging	Het
Amotl2	C	T	9: 102,723,769	T345I	probably benign	Het
Atf6b	A	T	17: 34,648,575		probably null	Het
Cacna1s	T	G	1: 136,076,732	F337C	probably damaging	Het
Cep85l	T	C	10: 53,298,184	I488V	probably damaging	Het
Cmas	T	A	6: 142,775,166	D375E	probably damaging	Het
Cnga4	T	C	7: 105,406,046	F279S	probably damaging	Het
Cyp4f37	T	C	17: 32,625,207	V95A	probably benign	Het
Dao	AGG	AG	5: 114,015,209		probably benign	Het
Dlg2	T	C	7: 92,417,258	F235S	probably benign	Het
Dmxl2	T	C	9: 54,446,881	D427G	possibly damaging	Het
Efl1	T	C	7: 82,692,970	Y529H	probably benign	Het
Epx	C	T	11: 87,872,721	M224I	probably benign	Het
Fetub	A	G	16: 22,929,699	R101G	possibly damaging	Het
Fubp1	T	A	3: 152,222,246		probably null	Het
Impdh2	C	T	9: 108,562,306	R153*	probably null	Het
Kcnj12	C	T	11: 61,069,604	Q243*	probably null	Het
Lrrn1	T	A	6: 107,567,850	V203E	probably damaging	Het
Meikin	T	C	11: 54,409,710	S338P	possibly damaging	Het
Myl10	A	T	5: 136,700,853		probably null	Het
Nt5c3b	T	C	11: 100,434,741	K120E	possibly damaging	Het
Olfr118	T	A	17: 37,672,656	L211H	probably damaging	Het
Olfr790	T	C	10: 129,501,847	L313S	probably benign	Het
Olfr802	G	A	10: 129,681,830	T303I	probably benign	Het
Olfr93	T	A	17: 37,151,186	N262I	possibly damaging	Het
Pdzd7	A	G	19: 45,036,225	S452P	probably benign	Het
Prune2	A	G	19: 17,201,670	I2982V	probably damaging	Het
Ptpdc1	G	A	13: 48,587,101	R285C	probably damaging	Het
Raf1	T	C	6: 115,620,288	D486G	probably damaging	Het
Rbm27	A	T	18: 42,275,480		probably benign	Het
Slit2	A	G	5: 48,304,036	Y1475C	possibly damaging	Het
Tgm5	G	T	2: 121,075,169	N168K	probably damaging	Het
Ugt2b38	A	G	5: 87,424,032	V47A	probably benign	Het
Ush2a	A	G	1: 188,826,371	H3599R	probably benign	Het
Veph1	T	C	3: 66,215,475	E211G	possibly damaging	Het
Wapl	T	A	14: 34,730,647	H832Q	probably damaging	Het
Zfp281	T	A	1: 136,626,034	V250D	probably benign	Het
Zfp36l2	A	G	17: 84,185,824	S462P	unknown	Het

Other mutations in Snx14

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00487:Snx14	APN	9	88402190	missense	probably damaging	0.99
IGL00773:Snx14	APN	9	88394539	missense	probably damaging	0.96
IGL00847:Snx14	APN	9	88420329	missense	probably damaging	1.00
IGL01526:Snx14	APN	9	88381500	missense	probably damaging	0.99
IGL01662:Snx14	APN	9	88385838	splice site	probably benign
IGL01928:Snx14	APN	9	88381512	missense	probably benign	0.04
IGL02225:Snx14	APN	9	88413524	missense	probably damaging	0.99
IGL02498:Snx14	APN	9	88407464	missense	probably damaging	1.00
IGL02585:Snx14	APN	9	88404518	missense	possibly damaging	0.92
IGL02634:Snx14	APN	9	88403303	missense	probably damaging	1.00
IGL03073:Snx14	APN	9	88422896	critical splice donor site	probably null
R0167:Snx14	UTSW	9	88407416	missense	probably damaging	1.00
R0324:Snx14	UTSW	9	88405238	critical splice donor site	probably null
R0627:Snx14	UTSW	9	88394430	missense	probably benign
R0862:Snx14	UTSW	9	88383996	missense	possibly damaging	0.81
R0864:Snx14	UTSW	9	88383996	missense	possibly damaging	0.81
R0973:Snx14	UTSW	9	88400721	critical splice donor site	probably null
R0973:Snx14	UTSW	9	88400721	critical splice donor site	probably null
R0974:Snx14	UTSW	9	88400721	critical splice donor site	probably null
R1478:Snx14	UTSW	9	88394528	missense	probably benign	0.00
R1511:Snx14	UTSW	9	88398364	nonsense	probably null
R1522:Snx14	UTSW	9	88402224	missense	possibly damaging	0.52
R1612:Snx14	UTSW	9	88376905	missense	possibly damaging	0.81
R1634:Snx14	UTSW	9	88385739	missense	probably benign	0.00
R1634:Snx14	UTSW	9	88407490	splice site	probably benign
R1704:Snx14	UTSW	9	88413538	missense	probably damaging	1.00
R1713:Snx14	UTSW	9	88415675	missense	probably damaging	1.00
R1883:Snx14	UTSW	9	88402261	missense	probably benign	0.01
R3701:Snx14	UTSW	9	88420243	splice site	probably benign
R3853:Snx14	UTSW	9	88407319	splice site	probably benign
R4301:Snx14	UTSW	9	88410623	missense	probably damaging	1.00
R4449:Snx14	UTSW	9	88422999	missense	probably benign	0.05
R4793:Snx14	UTSW	9	88394442	missense	probably damaging	0.98
R4934:Snx14	UTSW	9	88398288	missense	probably damaging	0.98
R5126:Snx14	UTSW	9	88382099	missense	probably damaging	1.00
R5227:Snx14	UTSW	9	88398294	missense	possibly damaging	0.77
R5518:Snx14	UTSW	9	88383802	missense	probably damaging	1.00
R5838:Snx14	UTSW	9	88391776	missense	probably damaging	1.00
R5957:Snx14	UTSW	9	88403274	missense	possibly damaging	0.84
R6153:Snx14	UTSW	9	88391806	missense	probably damaging	1.00
R6156:Snx14	UTSW	9	88407339	missense	possibly damaging	0.92
R6703:Snx14	UTSW	9	88422914	missense	probably damaging	0.96
R6784:Snx14	UTSW	9	88381792	missense	probably benign	0.01
R6823:Snx14	UTSW	9	88394382	missense	possibly damaging	0.90
R6837:Snx14	UTSW	9	88380223	missense	probably benign	0.07
R7169:Snx14	UTSW	9	88398309	missense	probably damaging	0.98
R7216:Snx14	UTSW	9	88381791	missense	probably damaging	0.99
R7224:Snx14	UTSW	9	88394561	missense	possibly damaging	0.92
R7357:Snx14	UTSW	9	88404316	missense	possibly damaging	0.49
R7738:Snx14	UTSW	9	88407474	missense	probably benign	0.00
R7743:Snx14	UTSW	9	88398349	missense	probably benign	0.01
R8016:Snx14	UTSW	9	88415687	missense	probably damaging	0.99
R8384:Snx14	UTSW	9	88403280	nonsense	probably null
R8492:Snx14	UTSW	9	88381816	missense	possibly damaging	0.94
R8686:Snx14	UTSW	9	88415693	missense	probably damaging	1.00
R8738:Snx14	UTSW	9	88407400	missense	possibly damaging	0.93
R8870:Snx14	UTSW	9	88413488	missense	probably benign	0.01
R9208:Snx14	UTSW	9	88383779	missense	probably benign	0.01
R9402:Snx14	UTSW	9	88407437	missense	probably damaging	1.00
R9620:Snx14	UTSW	9	88381741	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATGGGACCAACAGTGATTGATC -3'
(R):5'- TGCTGTACTTCCTATAGGGACATTAAG -3'

Sequencing Primer
(F):5'- ACTCCAGATTTCTCACTGT -3'
(R):5'- CTCTTGAGTTTGAAGACAGCCAG -3'

Posted On

2020-09-15