Incidental Mutation 'R7969:Amotl2'
ID 650508
Institutional Source Beutler Lab
Gene Symbol Amotl2
Ensembl Gene ENSMUSG00000032531
Gene Name angiomotin-like 2
Synonyms MASCOT, Lccp
MMRRC Submission 046012-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.154) question?
Stock # R7969 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 102594290-102610616 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 102600968 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 345 (T345I)
Ref Sequence ENSEMBL: ENSMUSP00000121113 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035121] [ENSMUST00000134483] [ENSMUST00000142011] [ENSMUST00000145913] [ENSMUST00000145937] [ENSMUST00000153965] [ENSMUST00000153911] [ENSMUST00000156485] [ENSMUST00000190047]
AlphaFold Q8K371
Predicted Effect probably benign
Transcript: ENSMUST00000035121
AA Change: T312I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000035121
Gene: ENSMUSG00000032531
AA Change: T312I

DomainStartEndE-ValueType
low complexity region 33 53 N/A INTRINSIC
low complexity region 72 83 N/A INTRINSIC
low complexity region 157 170 N/A INTRINSIC
low complexity region 192 215 N/A INTRINSIC
low complexity region 248 268 N/A INTRINSIC
Blast:PAC 352 393 1e-12 BLAST
low complexity region 422 436 N/A INTRINSIC
Pfam:Angiomotin_C 478 688 2.3e-98 PFAM
low complexity region 698 710 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000115845
Gene: ENSMUSG00000032531
AA Change: T126I

DomainStartEndE-ValueType
low complexity region 30 50 N/A INTRINSIC
Blast:PAC 134 175 8e-13 BLAST
low complexity region 204 218 N/A INTRINSIC
Pfam:Angiomotin_C 260 470 4.9e-98 PFAM
low complexity region 480 492 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134483
Predicted Effect probably benign
Transcript: ENSMUST00000142011
AA Change: T312I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000120378
Gene: ENSMUSG00000032531
AA Change: T312I

DomainStartEndE-ValueType
low complexity region 33 53 N/A INTRINSIC
low complexity region 72 83 N/A INTRINSIC
low complexity region 157 170 N/A INTRINSIC
low complexity region 192 215 N/A INTRINSIC
low complexity region 248 268 N/A INTRINSIC
Blast:PAC 352 393 1e-12 BLAST
low complexity region 422 436 N/A INTRINSIC
Pfam:Angiomotin_C 478 686 1.2e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145913
SMART Domains Protein: ENSMUSP00000118126
Gene: ENSMUSG00000032531

DomainStartEndE-ValueType
low complexity region 33 53 N/A INTRINSIC
low complexity region 72 83 N/A INTRINSIC
low complexity region 157 170 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145937
SMART Domains Protein: ENSMUSP00000114950
Gene: ENSMUSG00000032531

DomainStartEndE-ValueType
low complexity region 33 53 N/A INTRINSIC
low complexity region 72 83 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153965
AA Change: T345I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000121113
Gene: ENSMUSG00000032531
AA Change: T345I

DomainStartEndE-ValueType
low complexity region 66 86 N/A INTRINSIC
low complexity region 105 116 N/A INTRINSIC
low complexity region 190 203 N/A INTRINSIC
low complexity region 225 248 N/A INTRINSIC
low complexity region 281 301 N/A INTRINSIC
Blast:PAC 385 426 1e-12 BLAST
low complexity region 455 469 N/A INTRINSIC
Pfam:Angiomotin_C 511 719 3.7e-94 PFAM
low complexity region 731 743 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153911
SMART Domains Protein: ENSMUSP00000119903
Gene: ENSMUSG00000032531

DomainStartEndE-ValueType
low complexity region 56 76 N/A INTRINSIC
low complexity region 95 106 N/A INTRINSIC
low complexity region 180 193 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156485
SMART Domains Protein: ENSMUSP00000116554
Gene: ENSMUSG00000032531

DomainStartEndE-ValueType
low complexity region 33 53 N/A INTRINSIC
low complexity region 72 83 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190047
SMART Domains Protein: ENSMUSP00000140688
Gene: ENSMUSG00000032531

DomainStartEndE-ValueType
coiled coil region 1 114 N/A INTRINSIC
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Angiomotin is a protein that binds angiostatin, a circulating inhibitor of the formation of new blood vessels (angiogenesis). Angiomotin mediates angiostatin inhibition of endothelial cell migration and tube formation in vitro. The protein encoded by this gene is related to angiomotin and is a member of the motin protein family. Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, Jul 2013]
PHENOTYPE: Conditional homozygous knockout in endothelial cells during embryonic development leads to aortic restriction in the embryo. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A T 13: 81,588,344 (GRCm39) V4414E possibly damaging Het
Ahcyl2 T A 6: 29,870,663 (GRCm39) I193N probably damaging Het
Atf6b A T 17: 34,867,549 (GRCm39) probably null Het
Cacna1s T G 1: 136,004,470 (GRCm39) F337C probably damaging Het
Cep85l T C 10: 53,174,280 (GRCm39) I488V probably damaging Het
Cmas T A 6: 142,720,892 (GRCm39) D375E probably damaging Het
Cnga4 T C 7: 105,055,253 (GRCm39) F279S probably damaging Het
Cyp4f37 T C 17: 32,844,181 (GRCm39) V95A probably benign Het
Dao AGG AG 5: 114,153,270 (GRCm39) probably benign Het
Dlg2 T C 7: 92,066,466 (GRCm39) F235S probably benign Het
Dmxl2 T C 9: 54,354,165 (GRCm39) D427G possibly damaging Het
Efl1 T C 7: 82,342,178 (GRCm39) Y529H probably benign Het
Epx C T 11: 87,763,547 (GRCm39) M224I probably benign Het
Fetub A G 16: 22,748,449 (GRCm39) R101G possibly damaging Het
Fubp1 T A 3: 151,927,883 (GRCm39) probably null Het
Impdh2 C T 9: 108,439,505 (GRCm39) R153* probably null Het
Kcnj12 C T 11: 60,960,430 (GRCm39) Q243* probably null Het
Lrrn1 T A 6: 107,544,811 (GRCm39) V203E probably damaging Het
Meikin T C 11: 54,300,536 (GRCm39) S338P possibly damaging Het
Myl10 A T 5: 136,729,707 (GRCm39) probably null Het
Nt5c3b T C 11: 100,325,567 (GRCm39) K120E possibly damaging Het
Or10al2 T A 17: 37,983,547 (GRCm39) L211H probably damaging Het
Or2h1b T A 17: 37,462,077 (GRCm39) N262I possibly damaging Het
Or6c1 G A 10: 129,517,699 (GRCm39) T303I probably benign Het
Or6c75 T C 10: 129,337,716 (GRCm39) L313S probably benign Het
Pdzd7 A G 19: 45,024,664 (GRCm39) S452P probably benign Het
Prune2 A G 19: 17,179,034 (GRCm39) I2982V probably damaging Het
Ptpdc1 G A 13: 48,740,577 (GRCm39) R285C probably damaging Het
Raf1 T C 6: 115,597,249 (GRCm39) D486G probably damaging Het
Rbm27 A T 18: 42,408,545 (GRCm39) probably benign Het
Slit2 A G 5: 48,461,378 (GRCm39) Y1475C possibly damaging Het
Snx14 G A 9: 88,295,613 (GRCm39) T184M probably damaging Het
Tgm5 G T 2: 120,905,650 (GRCm39) N168K probably damaging Het
Ugt2b38 A G 5: 87,571,891 (GRCm39) V47A probably benign Het
Ush2a A G 1: 188,558,568 (GRCm39) H3599R probably benign Het
Veph1 T C 3: 66,122,896 (GRCm39) E211G possibly damaging Het
Wapl T A 14: 34,452,604 (GRCm39) H832Q probably damaging Het
Zfp281 T A 1: 136,553,772 (GRCm39) V250D probably benign Het
Zfp36l2 A G 17: 84,493,252 (GRCm39) S462P unknown Het
Other mutations in Amotl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02002:Amotl2 APN 9 102,602,316 (GRCm39) missense probably damaging 1.00
IGL02207:Amotl2 APN 9 102,601,896 (GRCm39) missense probably damaging 1.00
R0471:Amotl2 UTSW 9 102,597,718 (GRCm39) missense probably damaging 0.98
R1420:Amotl2 UTSW 9 102,601,982 (GRCm39) missense possibly damaging 0.91
R1483:Amotl2 UTSW 9 102,608,096 (GRCm39) missense probably benign 0.16
R1525:Amotl2 UTSW 9 102,605,767 (GRCm39) missense probably damaging 1.00
R1661:Amotl2 UTSW 9 102,607,295 (GRCm39) missense probably damaging 0.99
R1945:Amotl2 UTSW 9 102,597,753 (GRCm39) missense probably benign
R2113:Amotl2 UTSW 9 102,601,922 (GRCm39) nonsense probably null
R2157:Amotl2 UTSW 9 102,607,788 (GRCm39) unclassified probably benign
R4084:Amotl2 UTSW 9 102,601,884 (GRCm39) critical splice acceptor site probably null
R4726:Amotl2 UTSW 9 102,601,018 (GRCm39) missense probably benign 0.00
R4755:Amotl2 UTSW 9 102,597,679 (GRCm39) missense probably damaging 1.00
R4782:Amotl2 UTSW 9 102,597,322 (GRCm39) critical splice donor site probably null
R4819:Amotl2 UTSW 9 102,607,270 (GRCm39) missense probably damaging 1.00
R5048:Amotl2 UTSW 9 102,600,997 (GRCm39) missense probably benign 0.00
R5328:Amotl2 UTSW 9 102,600,967 (GRCm39) missense probably benign
R5894:Amotl2 UTSW 9 102,602,371 (GRCm39) missense possibly damaging 0.79
R6956:Amotl2 UTSW 9 102,601,967 (GRCm39) missense probably damaging 1.00
R7304:Amotl2 UTSW 9 102,605,549 (GRCm39) missense probably damaging 1.00
R7390:Amotl2 UTSW 9 102,608,889 (GRCm39) missense probably damaging 1.00
R7474:Amotl2 UTSW 9 102,607,310 (GRCm39) missense probably benign 0.00
R7816:Amotl2 UTSW 9 102,608,853 (GRCm39) missense probably benign 0.43
R7967:Amotl2 UTSW 9 102,600,968 (GRCm39) missense probably benign 0.00
R7970:Amotl2 UTSW 9 102,600,968 (GRCm39) missense probably benign 0.00
R7971:Amotl2 UTSW 9 102,600,968 (GRCm39) missense probably benign 0.00
R7972:Amotl2 UTSW 9 102,600,968 (GRCm39) missense probably benign 0.00
R7973:Amotl2 UTSW 9 102,600,968 (GRCm39) missense probably benign 0.00
R8017:Amotl2 UTSW 9 102,600,968 (GRCm39) missense probably benign 0.00
R8019:Amotl2 UTSW 9 102,600,968 (GRCm39) missense probably benign 0.00
R8045:Amotl2 UTSW 9 102,600,968 (GRCm39) missense probably benign 0.00
R8046:Amotl2 UTSW 9 102,600,968 (GRCm39) missense probably benign 0.00
R8131:Amotl2 UTSW 9 102,597,615 (GRCm39) missense probably damaging 1.00
R8754:Amotl2 UTSW 9 102,597,358 (GRCm39) missense possibly damaging 0.53
R8813:Amotl2 UTSW 9 102,607,291 (GRCm39) missense probably damaging 1.00
R9071:Amotl2 UTSW 9 102,595,892 (GRCm39) start gained probably benign
R9399:Amotl2 UTSW 9 102,606,531 (GRCm39) missense probably damaging 0.99
X0022:Amotl2 UTSW 9 102,606,669 (GRCm39) missense probably damaging 1.00
Z1088:Amotl2 UTSW 9 102,600,897 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- GGGCTCTGAGCTTTATTCACC -3'
(R):5'- ATGGTGCAAAAGGTAGCCTG -3'

Sequencing Primer
(F):5'- TTTCCCAGGATCCTGCAGG -3'
(R):5'- TGCAAAAGGTAGCCTGATAGG -3'
Posted On 2020-09-15