Mutagenetix > Incidental Mutation

Incidental Mutation 'R7969:Cep85l'

650510

Institutional Source

Beutler Lab

Gene Symbol

Cep85l

Ensembl Gene

ENSMUSG00000038594

Gene Name

centrosomal protein 85-like

Synonyms

Gm9766

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.173) question?

Stock #

R7969 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

53273443-53379947 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 53298184 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 488 (I488V)

Ref Sequence

ENSEMBL: ENSMUSP00000151909 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095691] [ENSMUST00000220376] [ENSMUST00000220443]

AlphaFold

A0A1W2P884

Predicted Effect

SMART Domains

Protein: ENSMUSP00000093356
Gene: ENSMUSG00000038594
AA Change: I386V

Domain	Start	End	E-Value	Type
coiled coil region	442	578	N/A	INTRINSIC
coiled coil region	600	645	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000220443
AA Change: I488V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene was identified as a breast cancer antigen. Nothing more is known of its function at this time. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2010]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrv1	A	T	13: 81,440,225	V4414E	possibly damaging	Het
Ahcyl2	T	A	6: 29,870,664	I193N	probably damaging	Het
Amotl2	C	T	9: 102,723,769	T345I	probably benign	Het
Atf6b	A	T	17: 34,648,575		probably null	Het
Cacna1s	T	G	1: 136,076,732	F337C	probably damaging	Het
Cmas	T	A	6: 142,775,166	D375E	probably damaging	Het
Cnga4	T	C	7: 105,406,046	F279S	probably damaging	Het
Cyp4f37	T	C	17: 32,625,207	V95A	probably benign	Het
Dao	AGG	AG	5: 114,015,209		probably benign	Het
Dlg2	T	C	7: 92,417,258	F235S	probably benign	Het
Dmxl2	T	C	9: 54,446,881	D427G	possibly damaging	Het
Efl1	T	C	7: 82,692,970	Y529H	probably benign	Het
Epx	C	T	11: 87,872,721	M224I	probably benign	Het
Fetub	A	G	16: 22,929,699	R101G	possibly damaging	Het
Fubp1	T	A	3: 152,222,246		probably null	Het
Impdh2	C	T	9: 108,562,306	R153*	probably null	Het
Kcnj12	C	T	11: 61,069,604	Q243*	probably null	Het
Lrrn1	T	A	6: 107,567,850	V203E	probably damaging	Het
Meikin	T	C	11: 54,409,710	S338P	possibly damaging	Het
Myl10	A	T	5: 136,700,853		probably null	Het
Nt5c3b	T	C	11: 100,434,741	K120E	possibly damaging	Het
Olfr118	T	A	17: 37,672,656	L211H	probably damaging	Het
Olfr790	T	C	10: 129,501,847	L313S	probably benign	Het
Olfr802	G	A	10: 129,681,830	T303I	probably benign	Het
Olfr93	T	A	17: 37,151,186	N262I	possibly damaging	Het
Pdzd7	A	G	19: 45,036,225	S452P	probably benign	Het
Prune2	A	G	19: 17,201,670	I2982V	probably damaging	Het
Ptpdc1	G	A	13: 48,587,101	R285C	probably damaging	Het
Raf1	T	C	6: 115,620,288	D486G	probably damaging	Het
Rbm27	A	T	18: 42,275,480		probably benign	Het
Slit2	A	G	5: 48,304,036	Y1475C	possibly damaging	Het
Snx14	G	A	9: 88,413,560	T184M	probably damaging	Het
Tgm5	G	T	2: 121,075,169	N168K	probably damaging	Het
Ugt2b38	A	G	5: 87,424,032	V47A	probably benign	Het
Ush2a	A	G	1: 188,826,371	H3599R	probably benign	Het
Veph1	T	C	3: 66,215,475	E211G	possibly damaging	Het
Wapl	T	A	14: 34,730,647	H832Q	probably damaging	Het
Zfp281	T	A	1: 136,626,034	V250D	probably benign	Het
Zfp36l2	A	G	17: 84,185,824	S462P	unknown	Het

Other mutations in Cep85l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
debauchery	UTSW	10	53348815	missense	possibly damaging	0.77
saturnalia	UTSW	10	53319594	splice site	probably null
R0103:Cep85l	UTSW	10	53278174	missense	possibly damaging	0.53
R0103:Cep85l	UTSW	10	53278174	missense	possibly damaging	0.53
R0559:Cep85l	UTSW	10	53348501	missense	probably benign	0.00
R0689:Cep85l	UTSW	10	53348847	missense	probably damaging	1.00
R0750:Cep85l	UTSW	10	53281546	missense	probably damaging	0.99
R0969:Cep85l	UTSW	10	53281496	missense	probably benign	0.00
R1375:Cep85l	UTSW	10	53349258	missense	probably damaging	0.99
R1542:Cep85l	UTSW	10	53301584	missense	probably damaging	1.00
R1611:Cep85l	UTSW	10	53348681	missense	probably benign
R1749:Cep85l	UTSW	10	53278154	missense	probably damaging	1.00
R1826:Cep85l	UTSW	10	53348812	missense	possibly damaging	0.89
R2007:Cep85l	UTSW	10	53278075	utr 3 prime	probably benign
R2043:Cep85l	UTSW	10	53358128	missense	possibly damaging	0.64
R2144:Cep85l	UTSW	10	53358126	missense	probably benign	0.04
R2186:Cep85l	UTSW	10	53348618	missense	probably damaging	0.97
R2201:Cep85l	UTSW	10	53348731	missense	probably benign	0.01
R3767:Cep85l	UTSW	10	53291810	missense	probably benign	0.09
R5249:Cep85l	UTSW	10	53319594	splice site	probably null
R5764:Cep85l	UTSW	10	53348994	missense	probably benign	0.00
R6207:Cep85l	UTSW	10	53281555	missense	probably benign
R6333:Cep85l	UTSW	10	53349101	nonsense	probably null
R6422:Cep85l	UTSW	10	53291780	missense	possibly damaging	0.62
R6511:Cep85l	UTSW	10	53278092	missense	probably benign	0.00
R6645:Cep85l	UTSW	10	53301672	missense	probably benign	0.26
R6863:Cep85l	UTSW	10	53349118	missense	probably damaging	1.00
R6904:Cep85l	UTSW	10	53349098	missense	probably benign	0.00
R7000:Cep85l	UTSW	10	53298199	missense	probably damaging	1.00
R7015:Cep85l	UTSW	10	53349055	missense	possibly damaging	0.89
R7256:Cep85l	UTSW	10	53296255	missense	probably damaging	1.00
R7425:Cep85l	UTSW	10	53301570	missense	probably damaging	1.00
R7583:Cep85l	UTSW	10	53281354	missense	probably damaging	1.00
R7796:Cep85l	UTSW	10	53281401	missense	probably damaging	0.96
R7960:Cep85l	UTSW	10	53296307	missense	probably benign
R8042:Cep85l	UTSW	10	53348663	missense	probably damaging	1.00
R8103:Cep85l	UTSW	10	53299324	splice site	probably null
R8251:Cep85l	UTSW	10	53281354	missense	probably damaging	1.00
R8460:Cep85l	UTSW	10	53349217	missense	probably benign	0.18
R8698:Cep85l	UTSW	10	53358105	missense	probably damaging	0.98
R8814:Cep85l	UTSW	10	53348969	missense	probably benign	0.00
R8888:Cep85l	UTSW	10	53348815	missense	possibly damaging	0.77
R8895:Cep85l	UTSW	10	53348815	missense	possibly damaging	0.77
R9090:Cep85l	UTSW	10	53281574	nonsense	probably null
R9271:Cep85l	UTSW	10	53281574	nonsense	probably null
R9293:Cep85l	UTSW	10	53298186	missense	probably damaging	1.00
R9478:Cep85l	UTSW	10	53348779	missense	possibly damaging	0.81

Predicted Primers

PCR Primer
(F):5'- TCTTGGGACAGTTTGCAATTTC -3'
(R):5'- GAATCTTAGACTGGATTAAGGCAGATC -3'

Sequencing Primer
(F):5'- CAGTTTGCAATTTCTAAGTAACCCC -3'
(R):5'- GACTGGATTAAGGCAGATCTTAATG -3'

Posted On

2020-09-15