Incidental Mutation 'R7969:Cep85l'
ID 650510
Institutional Source Beutler Lab
Gene Symbol Cep85l
Ensembl Gene ENSMUSG00000038594
Gene Name centrosomal protein 85-like
Synonyms Gm9766
MMRRC Submission 046012-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.167) question?
Stock # R7969 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 53149539-53256043 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 53174280 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 488 (I488V)
Ref Sequence ENSEMBL: ENSMUSP00000151909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095691] [ENSMUST00000220376] [ENSMUST00000220443]
AlphaFold A0A1W2P884
Predicted Effect
SMART Domains Protein: ENSMUSP00000093356
Gene: ENSMUSG00000038594
AA Change: I386V

DomainStartEndE-ValueType
coiled coil region 442 578 N/A INTRINSIC
coiled coil region 600 645 N/A INTRINSIC
Predicted Effect
Predicted Effect probably damaging
Transcript: ENSMUST00000220443
AA Change: I488V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene was identified as a breast cancer antigen. Nothing more is known of its function at this time. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A T 13: 81,588,344 (GRCm39) V4414E possibly damaging Het
Ahcyl2 T A 6: 29,870,663 (GRCm39) I193N probably damaging Het
Amotl2 C T 9: 102,600,968 (GRCm39) T345I probably benign Het
Atf6b A T 17: 34,867,549 (GRCm39) probably null Het
Cacna1s T G 1: 136,004,470 (GRCm39) F337C probably damaging Het
Cmas T A 6: 142,720,892 (GRCm39) D375E probably damaging Het
Cnga4 T C 7: 105,055,253 (GRCm39) F279S probably damaging Het
Cyp4f37 T C 17: 32,844,181 (GRCm39) V95A probably benign Het
Dao AGG AG 5: 114,153,270 (GRCm39) probably benign Het
Dlg2 T C 7: 92,066,466 (GRCm39) F235S probably benign Het
Dmxl2 T C 9: 54,354,165 (GRCm39) D427G possibly damaging Het
Efl1 T C 7: 82,342,178 (GRCm39) Y529H probably benign Het
Epx C T 11: 87,763,547 (GRCm39) M224I probably benign Het
Fetub A G 16: 22,748,449 (GRCm39) R101G possibly damaging Het
Fubp1 T A 3: 151,927,883 (GRCm39) probably null Het
Impdh2 C T 9: 108,439,505 (GRCm39) R153* probably null Het
Kcnj12 C T 11: 60,960,430 (GRCm39) Q243* probably null Het
Lrrn1 T A 6: 107,544,811 (GRCm39) V203E probably damaging Het
Meikin T C 11: 54,300,536 (GRCm39) S338P possibly damaging Het
Myl10 A T 5: 136,729,707 (GRCm39) probably null Het
Nt5c3b T C 11: 100,325,567 (GRCm39) K120E possibly damaging Het
Or10al2 T A 17: 37,983,547 (GRCm39) L211H probably damaging Het
Or2h1b T A 17: 37,462,077 (GRCm39) N262I possibly damaging Het
Or6c1 G A 10: 129,517,699 (GRCm39) T303I probably benign Het
Or6c75 T C 10: 129,337,716 (GRCm39) L313S probably benign Het
Pdzd7 A G 19: 45,024,664 (GRCm39) S452P probably benign Het
Prune2 A G 19: 17,179,034 (GRCm39) I2982V probably damaging Het
Ptpdc1 G A 13: 48,740,577 (GRCm39) R285C probably damaging Het
Raf1 T C 6: 115,597,249 (GRCm39) D486G probably damaging Het
Rbm27 A T 18: 42,408,545 (GRCm39) probably benign Het
Slit2 A G 5: 48,461,378 (GRCm39) Y1475C possibly damaging Het
Snx14 G A 9: 88,295,613 (GRCm39) T184M probably damaging Het
Tgm5 G T 2: 120,905,650 (GRCm39) N168K probably damaging Het
Ugt2b38 A G 5: 87,571,891 (GRCm39) V47A probably benign Het
Ush2a A G 1: 188,558,568 (GRCm39) H3599R probably benign Het
Veph1 T C 3: 66,122,896 (GRCm39) E211G possibly damaging Het
Wapl T A 14: 34,452,604 (GRCm39) H832Q probably damaging Het
Zfp281 T A 1: 136,553,772 (GRCm39) V250D probably benign Het
Zfp36l2 A G 17: 84,493,252 (GRCm39) S462P unknown Het
Other mutations in Cep85l
AlleleSourceChrCoordTypePredicted EffectPPH Score
debauchery UTSW 10 53,224,911 (GRCm39) missense possibly damaging 0.77
saturnalia UTSW 10 53,195,690 (GRCm39) splice site probably null
R0103:Cep85l UTSW 10 53,154,270 (GRCm39) missense possibly damaging 0.53
R0103:Cep85l UTSW 10 53,154,270 (GRCm39) missense possibly damaging 0.53
R0559:Cep85l UTSW 10 53,224,597 (GRCm39) missense probably benign 0.00
R0689:Cep85l UTSW 10 53,224,943 (GRCm39) missense probably damaging 1.00
R0750:Cep85l UTSW 10 53,157,642 (GRCm39) missense probably damaging 0.99
R0969:Cep85l UTSW 10 53,157,592 (GRCm39) missense probably benign 0.00
R1375:Cep85l UTSW 10 53,225,354 (GRCm39) missense probably damaging 0.99
R1542:Cep85l UTSW 10 53,177,680 (GRCm39) missense probably damaging 1.00
R1611:Cep85l UTSW 10 53,224,777 (GRCm39) missense probably benign
R1749:Cep85l UTSW 10 53,154,250 (GRCm39) missense probably damaging 1.00
R1826:Cep85l UTSW 10 53,224,908 (GRCm39) missense possibly damaging 0.89
R2007:Cep85l UTSW 10 53,154,171 (GRCm39) utr 3 prime probably benign
R2043:Cep85l UTSW 10 53,234,224 (GRCm39) missense possibly damaging 0.64
R2144:Cep85l UTSW 10 53,234,222 (GRCm39) missense probably benign 0.04
R2186:Cep85l UTSW 10 53,224,714 (GRCm39) missense probably damaging 0.97
R2201:Cep85l UTSW 10 53,224,827 (GRCm39) missense probably benign 0.01
R3767:Cep85l UTSW 10 53,167,906 (GRCm39) missense probably benign 0.09
R5249:Cep85l UTSW 10 53,195,690 (GRCm39) splice site probably null
R5764:Cep85l UTSW 10 53,225,090 (GRCm39) missense probably benign 0.00
R6207:Cep85l UTSW 10 53,157,651 (GRCm39) missense probably benign
R6333:Cep85l UTSW 10 53,225,197 (GRCm39) nonsense probably null
R6422:Cep85l UTSW 10 53,167,876 (GRCm39) missense possibly damaging 0.62
R6511:Cep85l UTSW 10 53,154,188 (GRCm39) missense probably benign 0.00
R6645:Cep85l UTSW 10 53,177,768 (GRCm39) missense probably benign 0.26
R6863:Cep85l UTSW 10 53,225,214 (GRCm39) missense probably damaging 1.00
R6904:Cep85l UTSW 10 53,225,194 (GRCm39) missense probably benign 0.00
R7000:Cep85l UTSW 10 53,174,295 (GRCm39) missense probably damaging 1.00
R7015:Cep85l UTSW 10 53,225,151 (GRCm39) missense possibly damaging 0.89
R7256:Cep85l UTSW 10 53,172,351 (GRCm39) missense probably damaging 1.00
R7425:Cep85l UTSW 10 53,177,666 (GRCm39) missense probably damaging 1.00
R7583:Cep85l UTSW 10 53,157,450 (GRCm39) missense probably damaging 1.00
R7796:Cep85l UTSW 10 53,157,497 (GRCm39) missense probably damaging 0.96
R7960:Cep85l UTSW 10 53,172,403 (GRCm39) missense probably benign
R8042:Cep85l UTSW 10 53,224,759 (GRCm39) missense probably damaging 1.00
R8103:Cep85l UTSW 10 53,175,420 (GRCm39) splice site probably null
R8251:Cep85l UTSW 10 53,157,450 (GRCm39) missense probably damaging 1.00
R8460:Cep85l UTSW 10 53,225,313 (GRCm39) missense probably benign 0.18
R8698:Cep85l UTSW 10 53,234,201 (GRCm39) missense probably damaging 0.98
R8814:Cep85l UTSW 10 53,225,065 (GRCm39) missense probably benign 0.00
R8888:Cep85l UTSW 10 53,224,911 (GRCm39) missense possibly damaging 0.77
R8895:Cep85l UTSW 10 53,224,911 (GRCm39) missense possibly damaging 0.77
R9090:Cep85l UTSW 10 53,157,670 (GRCm39) nonsense probably null
R9271:Cep85l UTSW 10 53,157,670 (GRCm39) nonsense probably null
R9293:Cep85l UTSW 10 53,174,282 (GRCm39) missense probably damaging 1.00
R9478:Cep85l UTSW 10 53,224,875 (GRCm39) missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- TCTTGGGACAGTTTGCAATTTC -3'
(R):5'- GAATCTTAGACTGGATTAAGGCAGATC -3'

Sequencing Primer
(F):5'- CAGTTTGCAATTTCTAAGTAACCCC -3'
(R):5'- GACTGGATTAAGGCAGATCTTAATG -3'
Posted On 2020-09-15