Incidental Mutation 'R7969:Epx'
ID650515
Institutional Source Beutler Lab
Gene Symbol Epx
Ensembl Gene ENSMUSG00000052234
Gene Nameeosinophil peroxidase
SynonymsEPO
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R7969 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location87864000-87875536 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 87872721 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 224 (M224I)
Ref Sequence ENSEMBL: ENSMUSP00000050497 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049768]
Predicted Effect probably benign
Transcript: ENSMUST00000049768
AA Change: M224I

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000050497
Gene: ENSMUSG00000052234
AA Change: M224I

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:An_peroxidase 146 690 8.3e-184 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the peroxidase superfamily of enzymes that is produced by eosinophils and plays a critical role in eliminating tissue-invasive parasites. The encoded preproprotein undergoes proteolytic processing to generate a heterodimeric enzyme that forms a predominant component of the intracellular granules of eosinophils. Mice lacking the encoded protein exhibit resistance to ulcerative colitis induced by dextran sulfate. [provided by RefSeq, Jul 2016]
PHENOTYPE: Targeted deletion of this gene results in ultrastructural changes of the eosinophil secondary granule but does not significantly alter the course of inflammation or development of allergic pulmonary pathologies in an ovalbumin-challenge model of pulmonary inflammation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A T 13: 81,440,225 V4414E possibly damaging Het
Ahcyl2 T A 6: 29,870,664 I193N probably damaging Het
Amotl2 C T 9: 102,723,769 T345I probably benign Het
Atf6b A T 17: 34,648,575 probably null Het
Cacna1s T G 1: 136,076,732 F337C probably damaging Het
Cep85l T C 10: 53,298,184 I488V probably damaging Het
Cmas T A 6: 142,775,166 D375E probably damaging Het
Cnga4 T C 7: 105,406,046 F279S probably damaging Het
Cyp4f37 T C 17: 32,625,207 V95A probably benign Het
Dao AGG AG 5: 114,015,209 probably benign Het
Dlg2 T C 7: 92,417,258 F235S probably benign Het
Dmxl2 T C 9: 54,446,881 D427G possibly damaging Het
Efl1 T C 7: 82,692,970 Y529H probably benign Het
Fetub A G 16: 22,929,699 R101G possibly damaging Het
Fubp1 T A 3: 152,222,246 probably null Het
Impdh2 C T 9: 108,562,306 R153* probably null Het
Kcnj12 C T 11: 61,069,604 Q243* probably null Het
Lrrn1 T A 6: 107,567,850 V203E probably damaging Het
Meikin T C 11: 54,409,710 S338P possibly damaging Het
Myl10 A T 5: 136,700,853 probably null Het
Nt5c3b T C 11: 100,434,741 K120E possibly damaging Het
Olfr118 T A 17: 37,672,656 L211H probably damaging Het
Olfr790 T C 10: 129,501,847 L313S probably benign Het
Olfr802 G A 10: 129,681,830 T303I probably benign Het
Olfr93 T A 17: 37,151,186 N262I possibly damaging Het
Pdzd7 A G 19: 45,036,225 S452P probably benign Het
Prune2 A G 19: 17,201,670 I2982V probably damaging Het
Ptpdc1 G A 13: 48,587,101 R285C probably damaging Het
Raf1 T C 6: 115,620,288 D486G probably damaging Het
Rbm27 A T 18: 42,275,480 probably benign Het
Slit2 A G 5: 48,304,036 Y1475C possibly damaging Het
Snx14 G A 9: 88,413,560 T184M probably damaging Het
Tgm5 G T 2: 121,075,169 N168K probably damaging Het
Ugt2b38 A G 5: 87,424,032 V47A probably benign Het
Ush2a A G 1: 188,826,371 H3599R probably benign Het
Veph1 T C 3: 66,215,475 E211G possibly damaging Het
Wapl T A 14: 34,730,647 H832Q probably damaging Het
Zfp281 T A 1: 136,626,034 V250D probably benign Het
Zfp36l2 A G 17: 84,185,824 S462P unknown Het
Other mutations in Epx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00543:Epx APN 11 87869925 missense probably damaging 1.00
IGL01723:Epx APN 11 87869402 missense probably damaging 1.00
IGL02096:Epx APN 11 87869468 missense probably damaging 1.00
IGL02423:Epx APN 11 87871318 missense possibly damaging 0.85
K7371:Epx UTSW 11 87864884 missense probably damaging 1.00
R1018:Epx UTSW 11 87869303 missense probably benign 0.05
R1607:Epx UTSW 11 87868712 missense probably damaging 1.00
R2017:Epx UTSW 11 87874337 missense probably damaging 1.00
R2030:Epx UTSW 11 87864824 missense probably damaging 1.00
R3838:Epx UTSW 11 87874830 missense probably damaging 1.00
R4417:Epx UTSW 11 87869430 nonsense probably null
R5083:Epx UTSW 11 87872680 missense probably damaging 0.99
R5712:Epx UTSW 11 87874853 nonsense probably null
R5935:Epx UTSW 11 87865492 missense probably damaging 1.00
R6830:Epx UTSW 11 87868626 missense probably damaging 1.00
R6857:Epx UTSW 11 87869955 nonsense probably null
R6984:Epx UTSW 11 87868598 missense probably damaging 1.00
R7031:Epx UTSW 11 87875523 start gained probably benign
R7652:Epx UTSW 11 87875334 critical splice donor site probably null
R7667:Epx UTSW 11 87874311 missense probably damaging 0.98
R8313:Epx UTSW 11 87872731 missense possibly damaging 0.71
R8559:Epx UTSW 11 87864792 missense probably damaging 0.99
X0065:Epx UTSW 11 87865475 missense probably benign 0.03
Z1177:Epx UTSW 11 87869261 missense probably damaging 1.00
Z1177:Epx UTSW 11 87869894 missense possibly damaging 0.56
Z1177:Epx UTSW 11 87872767 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTTCTGGGCTGGAAGCTACC -3'
(R):5'- TCTCTAACAACAGAAGAAGTGCCAG -3'

Sequencing Primer
(F):5'- CCCAGAAACCTAGAAGGCTGG -3'
(R):5'- TGGATGGGAGAGAGACAGCTC -3'
Posted On2020-09-15