Incidental Mutation 'R7969:Olfr93'
ID 650523
Institutional Source Beutler Lab
Gene Symbol Olfr93
Ensembl Gene ENSMUSG00000091601
Gene Name olfactory receptor 93
Synonyms GA_x6K02T2PSCP-1592036-1591098, MOR256-39P
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.088) question?
Stock # R7969 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 37140423-37161494 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 37151186 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Isoleucine at position 262 (N262I)
Ref Sequence ENSEMBL: ENSMUSP00000151672 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171679] [ENSMUST00000208003] [ENSMUST00000219235]
AlphaFold Q6UAH1
Predicted Effect possibly damaging
Transcript: ENSMUST00000171679
AA Change: N262I

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000125907
Gene: ENSMUSG00000091601
AA Change: N262I

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 5.7e-50 PFAM
Pfam:7tm_1 39 288 3.3e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000208003
AA Change: N108I

PolyPhen 2 Score 0.252 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect possibly damaging
Transcript: ENSMUST00000219235
AA Change: N262I

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A T 13: 81,440,225 V4414E possibly damaging Het
Ahcyl2 T A 6: 29,870,664 I193N probably damaging Het
Amotl2 C T 9: 102,723,769 T345I probably benign Het
Atf6b A T 17: 34,648,575 probably null Het
Cacna1s T G 1: 136,076,732 F337C probably damaging Het
Cep85l T C 10: 53,298,184 I488V probably damaging Het
Cmas T A 6: 142,775,166 D375E probably damaging Het
Cnga4 T C 7: 105,406,046 F279S probably damaging Het
Cyp4f37 T C 17: 32,625,207 V95A probably benign Het
Dao AGG AG 5: 114,015,209 probably benign Het
Dlg2 T C 7: 92,417,258 F235S probably benign Het
Dmxl2 T C 9: 54,446,881 D427G possibly damaging Het
Efl1 T C 7: 82,692,970 Y529H probably benign Het
Epx C T 11: 87,872,721 M224I probably benign Het
Fetub A G 16: 22,929,699 R101G possibly damaging Het
Fubp1 T A 3: 152,222,246 probably null Het
Impdh2 C T 9: 108,562,306 R153* probably null Het
Kcnj12 C T 11: 61,069,604 Q243* probably null Het
Lrrn1 T A 6: 107,567,850 V203E probably damaging Het
Meikin T C 11: 54,409,710 S338P possibly damaging Het
Myl10 A T 5: 136,700,853 probably null Het
Nt5c3b T C 11: 100,434,741 K120E possibly damaging Het
Olfr118 T A 17: 37,672,656 L211H probably damaging Het
Olfr790 T C 10: 129,501,847 L313S probably benign Het
Olfr802 G A 10: 129,681,830 T303I probably benign Het
Pdzd7 A G 19: 45,036,225 S452P probably benign Het
Prune2 A G 19: 17,201,670 I2982V probably damaging Het
Ptpdc1 G A 13: 48,587,101 R285C probably damaging Het
Raf1 T C 6: 115,620,288 D486G probably damaging Het
Rbm27 A T 18: 42,275,480 probably benign Het
Slit2 A G 5: 48,304,036 Y1475C possibly damaging Het
Snx14 G A 9: 88,413,560 T184M probably damaging Het
Tgm5 G T 2: 121,075,169 N168K probably damaging Het
Ugt2b38 A G 5: 87,424,032 V47A probably benign Het
Ush2a A G 1: 188,826,371 H3599R probably benign Het
Veph1 T C 3: 66,215,475 E211G possibly damaging Het
Wapl T A 14: 34,730,647 H832Q probably damaging Het
Zfp281 T A 1: 136,626,034 V250D probably benign Het
Zfp36l2 A G 17: 84,185,824 S462P unknown Het
Other mutations in Olfr93
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01087:Olfr93 APN 17 37151441 missense probably damaging 1.00
IGL02369:Olfr93 APN 17 37151774 missense probably damaging 1.00
IGL02392:Olfr93 APN 17 37151088 missense probably benign 0.03
IGL02516:Olfr93 APN 17 37151272 missense possibly damaging 0.95
IGL03089:Olfr93 APN 17 37151643 missense probably damaging 1.00
PIT4515001:Olfr93 UTSW 17 37151379 missense probably benign
R0396:Olfr93 UTSW 17 37151555 missense probably damaging 1.00
R2276:Olfr93 UTSW 17 37151254 nonsense probably null
R2278:Olfr93 UTSW 17 37151254 nonsense probably null
R3419:Olfr93 UTSW 17 37151351 missense probably damaging 0.99
R4254:Olfr93 UTSW 17 37151639 missense possibly damaging 0.90
R4353:Olfr93 UTSW 17 37151337 missense probably damaging 1.00
R4530:Olfr93 UTSW 17 37151607 missense possibly damaging 0.84
R4666:Olfr93 UTSW 17 37151379 missense possibly damaging 0.61
R5583:Olfr93 UTSW 17 37151594 missense probably benign 0.00
R5834:Olfr93 UTSW 17 37151799 missense probably damaging 1.00
R6348:Olfr93 UTSW 17 37151606 missense probably damaging 0.96
R6461:Olfr93 UTSW 17 37151471 missense probably damaging 1.00
R6788:Olfr93 UTSW 17 37151822 missense probably damaging 0.98
R8374:Olfr93 UTSW 17 37151745 missense probably damaging 0.97
R9126:Olfr93 UTSW 17 37151232 missense possibly damaging 0.90
R9298:Olfr93 UTSW 17 37151681 missense probably damaging 1.00
Z1177:Olfr93 UTSW 17 37151825 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCAGAAATCACACAAGTATTTGCCC -3'
(R):5'- GGACACCACTTTTAATGAGATTCAG -3'

Sequencing Primer
(F):5'- ACACAAGTATTTGCCCTTAGTTTC -3'
(R):5'- AGTTGCAGGTGTCATCTTCC -3'
Posted On 2020-09-15