Incidental Mutation 'R7969:Or10al2'
ID 650524
Institutional Source Beutler Lab
Gene Symbol Or10al2
Ensembl Gene ENSMUSG00000080990
Gene Name olfactory receptor family 10 subfamily AL member 2
Synonyms GA_x6K02T2PSCP-2131124-2132089, MOR263-13, Olfr118
MMRRC Submission 046012-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.070) question?
Stock # R7969 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 37982916-37983888 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 37983547 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Histidine at position 211 (L211H)
Ref Sequence ENSEMBL: ENSMUSP00000150176 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000122036] [ENSMUST00000215811] [ENSMUST00000216551]
AlphaFold Q7TRJ6
Predicted Effect probably damaging
Transcript: ENSMUST00000122036
AA Change: L211H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113988
Gene: ENSMUSG00000080990
AA Change: L211H

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srv 32 173 2e-6 PFAM
Pfam:7tm_4 37 314 2.1e-57 PFAM
Pfam:7TM_GPCR_Srsx 41 311 5.8e-6 PFAM
Pfam:7tm_1 47 296 1.4e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215811
AA Change: L211H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000216551
AA Change: L211H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A T 13: 81,588,344 (GRCm39) V4414E possibly damaging Het
Ahcyl2 T A 6: 29,870,663 (GRCm39) I193N probably damaging Het
Amotl2 C T 9: 102,600,968 (GRCm39) T345I probably benign Het
Atf6b A T 17: 34,867,549 (GRCm39) probably null Het
Cacna1s T G 1: 136,004,470 (GRCm39) F337C probably damaging Het
Cep85l T C 10: 53,174,280 (GRCm39) I488V probably damaging Het
Cmas T A 6: 142,720,892 (GRCm39) D375E probably damaging Het
Cnga4 T C 7: 105,055,253 (GRCm39) F279S probably damaging Het
Cyp4f37 T C 17: 32,844,181 (GRCm39) V95A probably benign Het
Dao AGG AG 5: 114,153,270 (GRCm39) probably benign Het
Dlg2 T C 7: 92,066,466 (GRCm39) F235S probably benign Het
Dmxl2 T C 9: 54,354,165 (GRCm39) D427G possibly damaging Het
Efl1 T C 7: 82,342,178 (GRCm39) Y529H probably benign Het
Epx C T 11: 87,763,547 (GRCm39) M224I probably benign Het
Fetub A G 16: 22,748,449 (GRCm39) R101G possibly damaging Het
Fubp1 T A 3: 151,927,883 (GRCm39) probably null Het
Impdh2 C T 9: 108,439,505 (GRCm39) R153* probably null Het
Kcnj12 C T 11: 60,960,430 (GRCm39) Q243* probably null Het
Lrrn1 T A 6: 107,544,811 (GRCm39) V203E probably damaging Het
Meikin T C 11: 54,300,536 (GRCm39) S338P possibly damaging Het
Myl10 A T 5: 136,729,707 (GRCm39) probably null Het
Nt5c3b T C 11: 100,325,567 (GRCm39) K120E possibly damaging Het
Or2h1b T A 17: 37,462,077 (GRCm39) N262I possibly damaging Het
Or6c1 G A 10: 129,517,699 (GRCm39) T303I probably benign Het
Or6c75 T C 10: 129,337,716 (GRCm39) L313S probably benign Het
Pdzd7 A G 19: 45,024,664 (GRCm39) S452P probably benign Het
Prune2 A G 19: 17,179,034 (GRCm39) I2982V probably damaging Het
Ptpdc1 G A 13: 48,740,577 (GRCm39) R285C probably damaging Het
Raf1 T C 6: 115,597,249 (GRCm39) D486G probably damaging Het
Rbm27 A T 18: 42,408,545 (GRCm39) probably benign Het
Slit2 A G 5: 48,461,378 (GRCm39) Y1475C possibly damaging Het
Snx14 G A 9: 88,295,613 (GRCm39) T184M probably damaging Het
Tgm5 G T 2: 120,905,650 (GRCm39) N168K probably damaging Het
Ugt2b38 A G 5: 87,571,891 (GRCm39) V47A probably benign Het
Ush2a A G 1: 188,558,568 (GRCm39) H3599R probably benign Het
Veph1 T C 3: 66,122,896 (GRCm39) E211G possibly damaging Het
Wapl T A 14: 34,452,604 (GRCm39) H832Q probably damaging Het
Zfp281 T A 1: 136,553,772 (GRCm39) V250D probably benign Het
Zfp36l2 A G 17: 84,493,252 (GRCm39) S462P unknown Het
Other mutations in Or10al2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01300:Or10al2 APN 17 37,983,778 (GRCm39) missense probably damaging 1.00
IGL02456:Or10al2 APN 17 37,983,340 (GRCm39) missense possibly damaging 0.90
IGL02750:Or10al2 APN 17 37,983,500 (GRCm39) nonsense probably null
IGL03083:Or10al2 APN 17 37,983,551 (GRCm39) nonsense probably null
IGL03339:Or10al2 APN 17 37,983,448 (GRCm39) missense possibly damaging 0.87
R0032:Or10al2 UTSW 17 37,983,378 (GRCm39) missense probably damaging 1.00
R1457:Or10al2 UTSW 17 37,983,816 (GRCm39) nonsense probably null
R1542:Or10al2 UTSW 17 37,983,142 (GRCm39) missense probably damaging 1.00
R1771:Or10al2 UTSW 17 37,983,554 (GRCm39) missense probably damaging 1.00
R1893:Or10al2 UTSW 17 37,983,747 (GRCm39) nonsense probably null
R2395:Or10al2 UTSW 17 37,983,587 (GRCm39) nonsense probably null
R3619:Or10al2 UTSW 17 37,983,531 (GRCm39) missense probably benign 0.05
R3917:Or10al2 UTSW 17 37,983,684 (GRCm39) missense probably damaging 1.00
R3937:Or10al2 UTSW 17 37,983,858 (GRCm39) missense probably benign 0.01
R5600:Or10al2 UTSW 17 37,983,176 (GRCm39) missense possibly damaging 0.91
R6415:Or10al2 UTSW 17 37,983,448 (GRCm39) missense possibly damaging 0.87
R6462:Or10al2 UTSW 17 37,983,111 (GRCm39) missense probably damaging 1.00
R7355:Or10al2 UTSW 17 37,983,301 (GRCm39) missense probably benign 0.02
R7861:Or10al2 UTSW 17 37,983,408 (GRCm39) missense possibly damaging 0.91
R7913:Or10al2 UTSW 17 37,982,999 (GRCm39) missense probably benign
R7952:Or10al2 UTSW 17 37,983,708 (GRCm39) missense probably damaging 1.00
R8879:Or10al2 UTSW 17 37,983,302 (GRCm39) nonsense probably null
R8923:Or10al2 UTSW 17 37,983,702 (GRCm39) missense probably benign 0.00
R9253:Or10al2 UTSW 17 37,983,637 (GRCm39) missense probably benign 0.00
R9778:Or10al2 UTSW 17 37,983,145 (GRCm39) missense probably damaging 0.97
R9789:Or10al2 UTSW 17 37,983,059 (GRCm39) missense probably damaging 1.00
RF003:Or10al2 UTSW 17 37,983,749 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTACATGGCCATATGCTCCC -3'
(R):5'- GGCTAGATTTGGGCCTCAAG -3'

Sequencing Primer
(F):5'- CCCATTTGGCATTAGTTTCATGG -3'
(R):5'- CCTCAAGTAGGTAATAGATCCTGAGC -3'
Posted On 2020-09-15