Incidental Mutation 'R7969:Zfp36l2'
ID 650525
Institutional Source Beutler Lab
Gene Symbol Zfp36l2
Ensembl Gene ENSMUSG00000045817
Gene Name zinc finger protein 36, C3H type-like 2
Synonyms ERF2, Brf2, Tis11d
MMRRC Submission 046012-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.856) question?
Stock # R7969 (G1)
Quality Score 181.009
Status Not validated
Chromosome 17
Chromosomal Location 84491359-84495375 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 84493252 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 462 (S462P)
Ref Sequence ENSEMBL: ENSMUSP00000050820 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047524] [ENSMUST00000060366]
AlphaFold P23949
Predicted Effect probably benign
Transcript: ENSMUST00000047524
SMART Domains Protein: ENSMUSP00000041701
Gene: ENSMUSG00000024251

DomainStartEndE-ValueType
SCOP:d1gw5a_ 457 926 3e-6 SMART
Pfam:DUF2428 938 1239 1.6e-93 PFAM
SCOP:d1gw5a_ 1343 1802 7e-6 SMART
Predicted Effect unknown
Transcript: ENSMUST00000060366
AA Change: S462P
SMART Domains Protein: ENSMUSP00000050820
Gene: ENSMUSG00000045817
AA Change: S462P

DomainStartEndE-ValueType
Pfam:Tis11B_N 1 144 1.5e-43 PFAM
ZnF_C3H1 155 182 9.8e-9 SMART
ZnF_C3H1 193 220 2.1e-8 SMART
low complexity region 223 235 N/A INTRINSIC
low complexity region 286 340 N/A INTRINSIC
low complexity region 345 364 N/A INTRINSIC
low complexity region 401 418 N/A INTRINSIC
low complexity region 436 470 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the TIS11 family of early response genes. Family members are induced by various agonists such as the phorbol ester TPA and the polypeptide mitogen EGF. The encoded protein contains a distinguishing putative zinc finger domain with a repeating cys-his motif. This putative nuclear transcription factor most likely functions in regulating the response to growth factors. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice expressing decreased levels of an amino-terminal truncated protein display female infertility whereas mice homozygous for a null allele die within two weeks as a result of hematopoietic system defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A T 13: 81,588,344 (GRCm39) V4414E possibly damaging Het
Ahcyl2 T A 6: 29,870,663 (GRCm39) I193N probably damaging Het
Amotl2 C T 9: 102,600,968 (GRCm39) T345I probably benign Het
Atf6b A T 17: 34,867,549 (GRCm39) probably null Het
Cacna1s T G 1: 136,004,470 (GRCm39) F337C probably damaging Het
Cep85l T C 10: 53,174,280 (GRCm39) I488V probably damaging Het
Cmas T A 6: 142,720,892 (GRCm39) D375E probably damaging Het
Cnga4 T C 7: 105,055,253 (GRCm39) F279S probably damaging Het
Cyp4f37 T C 17: 32,844,181 (GRCm39) V95A probably benign Het
Dao AGG AG 5: 114,153,270 (GRCm39) probably benign Het
Dlg2 T C 7: 92,066,466 (GRCm39) F235S probably benign Het
Dmxl2 T C 9: 54,354,165 (GRCm39) D427G possibly damaging Het
Efl1 T C 7: 82,342,178 (GRCm39) Y529H probably benign Het
Epx C T 11: 87,763,547 (GRCm39) M224I probably benign Het
Fetub A G 16: 22,748,449 (GRCm39) R101G possibly damaging Het
Fubp1 T A 3: 151,927,883 (GRCm39) probably null Het
Impdh2 C T 9: 108,439,505 (GRCm39) R153* probably null Het
Kcnj12 C T 11: 60,960,430 (GRCm39) Q243* probably null Het
Lrrn1 T A 6: 107,544,811 (GRCm39) V203E probably damaging Het
Meikin T C 11: 54,300,536 (GRCm39) S338P possibly damaging Het
Myl10 A T 5: 136,729,707 (GRCm39) probably null Het
Nt5c3b T C 11: 100,325,567 (GRCm39) K120E possibly damaging Het
Or10al2 T A 17: 37,983,547 (GRCm39) L211H probably damaging Het
Or2h1b T A 17: 37,462,077 (GRCm39) N262I possibly damaging Het
Or6c1 G A 10: 129,517,699 (GRCm39) T303I probably benign Het
Or6c75 T C 10: 129,337,716 (GRCm39) L313S probably benign Het
Pdzd7 A G 19: 45,024,664 (GRCm39) S452P probably benign Het
Prune2 A G 19: 17,179,034 (GRCm39) I2982V probably damaging Het
Ptpdc1 G A 13: 48,740,577 (GRCm39) R285C probably damaging Het
Raf1 T C 6: 115,597,249 (GRCm39) D486G probably damaging Het
Rbm27 A T 18: 42,408,545 (GRCm39) probably benign Het
Slit2 A G 5: 48,461,378 (GRCm39) Y1475C possibly damaging Het
Snx14 G A 9: 88,295,613 (GRCm39) T184M probably damaging Het
Tgm5 G T 2: 120,905,650 (GRCm39) N168K probably damaging Het
Ugt2b38 A G 5: 87,571,891 (GRCm39) V47A probably benign Het
Ush2a A G 1: 188,558,568 (GRCm39) H3599R probably benign Het
Veph1 T C 3: 66,122,896 (GRCm39) E211G possibly damaging Het
Wapl T A 14: 34,452,604 (GRCm39) H832Q probably damaging Het
Zfp281 T A 1: 136,553,772 (GRCm39) V250D probably benign Het
Other mutations in Zfp36l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1219:Zfp36l2 UTSW 17 84,495,070 (GRCm39) critical splice donor site probably null
R1918:Zfp36l2 UTSW 17 84,494,164 (GRCm39) missense probably damaging 0.98
R2126:Zfp36l2 UTSW 17 84,494,403 (GRCm39) missense probably damaging 0.99
R4727:Zfp36l2 UTSW 17 84,495,089 (GRCm39) missense probably benign 0.07
R4915:Zfp36l2 UTSW 17 84,493,690 (GRCm39) unclassified probably benign
R6213:Zfp36l2 UTSW 17 84,493,980 (GRCm39) missense probably damaging 0.98
R6814:Zfp36l2 UTSW 17 84,493,521 (GRCm39) unclassified probably benign
R7011:Zfp36l2 UTSW 17 84,493,861 (GRCm39) missense possibly damaging 0.61
R7455:Zfp36l2 UTSW 17 84,494,575 (GRCm39) missense probably damaging 0.99
R7706:Zfp36l2 UTSW 17 84,494,346 (GRCm39) missense probably benign 0.19
R7936:Zfp36l2 UTSW 17 84,495,090 (GRCm39) missense probably benign 0.16
R8163:Zfp36l2 UTSW 17 84,494,551 (GRCm39) missense possibly damaging 0.91
R8296:Zfp36l2 UTSW 17 84,494,552 (GRCm39) missense probably damaging 0.99
R9634:Zfp36l2 UTSW 17 84,494,056 (GRCm39) missense probably damaging 1.00
R9700:Zfp36l2 UTSW 17 84,494,184 (GRCm39) missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AGTTCGAGTCCAAGTGCTCG -3'
(R):5'- AACAACGCCTTCGCTTTCG -3'

Sequencing Primer
(F):5'- AGTCCAAGTGCTCGGAGGG -3'
(R):5'- TGAGCAGCCTCATCACGC -3'
Posted On 2020-09-15