Incidental Mutation 'R7969:Prune2'
ID 650527
Institutional Source Beutler Lab
Gene Symbol Prune2
Ensembl Gene ENSMUSG00000039126
Gene Name prune homolog 2
Synonyms A230083H22Rik, A330102H22Rik, 6330414G02Rik, Olfaxin
MMRRC Submission 046012-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7969 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 16933482-17201296 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 17179034 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 2982 (I2982V)
Ref Sequence ENSEMBL: ENSMUSP00000084977 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087689] [ENSMUST00000223920] [ENSMUST00000225351]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000087689
AA Change: I2982V

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000084977
Gene: ENSMUSG00000039126
AA Change: I2982V

DomainStartEndE-ValueType
DHHA2 208 351 8.32e-17 SMART
low complexity region 433 445 N/A INTRINSIC
low complexity region 476 488 N/A INTRINSIC
low complexity region 547 553 N/A INTRINSIC
low complexity region 962 975 N/A INTRINSIC
low complexity region 1071 1082 N/A INTRINSIC
low complexity region 1368 1378 N/A INTRINSIC
low complexity region 1533 1545 N/A INTRINSIC
low complexity region 1668 1685 N/A INTRINSIC
low complexity region 1740 1751 N/A INTRINSIC
low complexity region 2162 2175 N/A INTRINSIC
low complexity region 2222 2233 N/A INTRINSIC
low complexity region 2591 2606 N/A INTRINSIC
low complexity region 2731 2744 N/A INTRINSIC
SEC14 2882 3037 2.08e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000223920
AA Change: I233V

PolyPhen 2 Score 0.419 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000225351
AA Change: I233V

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000226052
AA Change: I259V

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the B-cell CLL/lymphoma 2 and adenovirus E1B 19 kDa interacting family, whose members play roles in many cellular processes including apotosis, cell transformation, and synaptic function. Several functions for this protein have been demonstrated including suppression of Ras homolog family member A activity, which results in reduced stress fiber formation and suppression of oncogenic cellular transformation. A high molecular weight isoform of this protein has also been shown to colocalize with Adaptor protein complex 2, beta-Adaptin and endodermal markers, suggesting an involvement in post-endocytic trafficking. In prostate cancer cells, this gene acts as a tumor suppressor and its expression is regulated by prostate cancer antigen 3, a non-protein coding gene on the opposite DNA strand in an intron of this gene. Prostate cancer antigen 3 regulates levels of this gene through formation of a double-stranded RNA that undergoes adenosine deaminase actin on RNA-dependent adenosine-to-inosine RNA editing. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2015]
Allele List at MGI

All alleles(160) : Gene trapped(160)

Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A T 13: 81,588,344 (GRCm39) V4414E possibly damaging Het
Ahcyl2 T A 6: 29,870,663 (GRCm39) I193N probably damaging Het
Amotl2 C T 9: 102,600,968 (GRCm39) T345I probably benign Het
Atf6b A T 17: 34,867,549 (GRCm39) probably null Het
Cacna1s T G 1: 136,004,470 (GRCm39) F337C probably damaging Het
Cep85l T C 10: 53,174,280 (GRCm39) I488V probably damaging Het
Cmas T A 6: 142,720,892 (GRCm39) D375E probably damaging Het
Cnga4 T C 7: 105,055,253 (GRCm39) F279S probably damaging Het
Cyp4f37 T C 17: 32,844,181 (GRCm39) V95A probably benign Het
Dao AGG AG 5: 114,153,270 (GRCm39) probably benign Het
Dlg2 T C 7: 92,066,466 (GRCm39) F235S probably benign Het
Dmxl2 T C 9: 54,354,165 (GRCm39) D427G possibly damaging Het
Efl1 T C 7: 82,342,178 (GRCm39) Y529H probably benign Het
Epx C T 11: 87,763,547 (GRCm39) M224I probably benign Het
Fetub A G 16: 22,748,449 (GRCm39) R101G possibly damaging Het
Fubp1 T A 3: 151,927,883 (GRCm39) probably null Het
Impdh2 C T 9: 108,439,505 (GRCm39) R153* probably null Het
Kcnj12 C T 11: 60,960,430 (GRCm39) Q243* probably null Het
Lrrn1 T A 6: 107,544,811 (GRCm39) V203E probably damaging Het
Meikin T C 11: 54,300,536 (GRCm39) S338P possibly damaging Het
Myl10 A T 5: 136,729,707 (GRCm39) probably null Het
Nt5c3b T C 11: 100,325,567 (GRCm39) K120E possibly damaging Het
Or10al2 T A 17: 37,983,547 (GRCm39) L211H probably damaging Het
Or2h1b T A 17: 37,462,077 (GRCm39) N262I possibly damaging Het
Or6c1 G A 10: 129,517,699 (GRCm39) T303I probably benign Het
Or6c75 T C 10: 129,337,716 (GRCm39) L313S probably benign Het
Pdzd7 A G 19: 45,024,664 (GRCm39) S452P probably benign Het
Ptpdc1 G A 13: 48,740,577 (GRCm39) R285C probably damaging Het
Raf1 T C 6: 115,597,249 (GRCm39) D486G probably damaging Het
Rbm27 A T 18: 42,408,545 (GRCm39) probably benign Het
Slit2 A G 5: 48,461,378 (GRCm39) Y1475C possibly damaging Het
Snx14 G A 9: 88,295,613 (GRCm39) T184M probably damaging Het
Tgm5 G T 2: 120,905,650 (GRCm39) N168K probably damaging Het
Ugt2b38 A G 5: 87,571,891 (GRCm39) V47A probably benign Het
Ush2a A G 1: 188,558,568 (GRCm39) H3599R probably benign Het
Veph1 T C 3: 66,122,896 (GRCm39) E211G possibly damaging Het
Wapl T A 14: 34,452,604 (GRCm39) H832Q probably damaging Het
Zfp281 T A 1: 136,553,772 (GRCm39) V250D probably benign Het
Zfp36l2 A G 17: 84,493,252 (GRCm39) S462P unknown Het
Other mutations in Prune2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Prune2 APN 19 17,145,708 (GRCm39) critical splice donor site probably null
IGL00848:Prune2 APN 19 17,096,482 (GRCm39) missense probably damaging 1.00
IGL00862:Prune2 APN 19 17,096,713 (GRCm39) missense probably benign 0.41
IGL00915:Prune2 APN 19 16,993,617 (GRCm39) missense probably damaging 1.00
IGL01084:Prune2 APN 19 17,095,573 (GRCm39) missense probably benign 0.19
IGL01109:Prune2 APN 19 17,101,243 (GRCm39) missense probably benign 0.03
IGL01372:Prune2 APN 19 17,102,433 (GRCm39) missense probably damaging 1.00
IGL01650:Prune2 APN 19 17,145,656 (GRCm39) missense possibly damaging 0.95
IGL01752:Prune2 APN 19 17,101,267 (GRCm39) missense possibly damaging 0.50
IGL01812:Prune2 APN 19 16,981,141 (GRCm39) missense possibly damaging 0.50
IGL01902:Prune2 APN 19 17,096,002 (GRCm39) missense probably benign 0.00
IGL02195:Prune2 APN 19 17,096,921 (GRCm39) missense probably benign 0.00
IGL02502:Prune2 APN 19 17,101,245 (GRCm39) missense probably benign 0.00
IGL02569:Prune2 APN 19 17,156,223 (GRCm39) missense probably damaging 0.99
IGL02693:Prune2 APN 19 17,101,855 (GRCm39) missense probably benign 0.03
IGL02737:Prune2 APN 19 17,170,775 (GRCm39) nonsense probably null
IGL02794:Prune2 APN 19 17,096,725 (GRCm39) missense probably benign 0.19
IGL02985:Prune2 APN 19 16,993,723 (GRCm39) critical splice donor site probably null
IGL03349:Prune2 APN 19 17,100,710 (GRCm39) missense probably damaging 1.00
3-1:Prune2 UTSW 19 17,102,646 (GRCm39) missense probably benign 0.00
R0060:Prune2 UTSW 19 16,981,097 (GRCm39) missense probably damaging 1.00
R0098:Prune2 UTSW 19 17,101,267 (GRCm39) missense possibly damaging 0.50
R0098:Prune2 UTSW 19 17,101,267 (GRCm39) missense possibly damaging 0.50
R0165:Prune2 UTSW 19 17,099,974 (GRCm39) missense probably benign 0.00
R0277:Prune2 UTSW 19 17,098,753 (GRCm39) missense probably damaging 0.99
R0321:Prune2 UTSW 19 17,099,818 (GRCm39) missense probably benign 0.39
R0321:Prune2 UTSW 19 17,098,291 (GRCm39) missense possibly damaging 0.78
R0374:Prune2 UTSW 19 17,098,274 (GRCm39) missense probably benign 0.00
R0380:Prune2 UTSW 19 17,101,371 (GRCm39) missense probably damaging 1.00
R0396:Prune2 UTSW 19 17,100,444 (GRCm39) missense probably benign 0.35
R0408:Prune2 UTSW 19 17,099,674 (GRCm39) missense probably benign 0.00
R0421:Prune2 UTSW 19 17,100,675 (GRCm39) missense probably benign 0.02
R0480:Prune2 UTSW 19 16,984,156 (GRCm39) splice site probably benign
R0531:Prune2 UTSW 19 16,984,117 (GRCm39) missense probably damaging 1.00
R0546:Prune2 UTSW 19 16,998,030 (GRCm39) splice site probably benign
R0554:Prune2 UTSW 19 17,102,582 (GRCm39) nonsense probably null
R0659:Prune2 UTSW 19 17,100,199 (GRCm39) missense probably damaging 1.00
R0699:Prune2 UTSW 19 17,101,319 (GRCm39) missense probably damaging 1.00
R0781:Prune2 UTSW 19 17,102,586 (GRCm39) missense probably benign
R1110:Prune2 UTSW 19 17,102,586 (GRCm39) missense probably benign
R1178:Prune2 UTSW 19 17,100,469 (GRCm39) missense probably benign 0.22
R1181:Prune2 UTSW 19 17,100,469 (GRCm39) missense probably benign 0.22
R1337:Prune2 UTSW 19 17,096,971 (GRCm39) missense possibly damaging 0.70
R1356:Prune2 UTSW 19 17,189,681 (GRCm39) missense probably benign 0.40
R1385:Prune2 UTSW 19 17,102,312 (GRCm39) missense possibly damaging 0.50
R1659:Prune2 UTSW 19 17,098,015 (GRCm39) missense possibly damaging 0.59
R1738:Prune2 UTSW 19 17,102,374 (GRCm39) missense probably benign 0.01
R1756:Prune2 UTSW 19 17,101,068 (GRCm39) missense probably benign 0.01
R1765:Prune2 UTSW 19 17,102,962 (GRCm39) missense probably damaging 1.00
R1782:Prune2 UTSW 19 17,099,537 (GRCm39) missense probably benign 0.00
R1817:Prune2 UTSW 19 17,099,445 (GRCm39) missense probably benign 0.00
R1838:Prune2 UTSW 19 17,177,242 (GRCm39) missense probably damaging 1.00
R1851:Prune2 UTSW 19 17,176,503 (GRCm39) missense probably damaging 1.00
R1852:Prune2 UTSW 19 17,176,503 (GRCm39) missense probably damaging 1.00
R1866:Prune2 UTSW 19 17,100,856 (GRCm39) missense probably damaging 1.00
R1911:Prune2 UTSW 19 17,091,038 (GRCm39) missense probably benign 0.02
R1983:Prune2 UTSW 19 16,998,006 (GRCm39) missense probably damaging 0.97
R2014:Prune2 UTSW 19 17,097,887 (GRCm39) missense probably damaging 1.00
R2066:Prune2 UTSW 19 17,098,042 (GRCm39) missense possibly damaging 0.57
R2088:Prune2 UTSW 19 17,097,109 (GRCm39) missense possibly damaging 0.95
R2111:Prune2 UTSW 19 17,185,602 (GRCm39) missense probably damaging 1.00
R2128:Prune2 UTSW 19 17,099,786 (GRCm39) missense probably benign 0.00
R2165:Prune2 UTSW 19 17,097,546 (GRCm39) missense probably benign 0.19
R2241:Prune2 UTSW 19 17,100,456 (GRCm39) missense probably damaging 0.96
R2278:Prune2 UTSW 19 17,095,919 (GRCm39) missense possibly damaging 0.93
R2504:Prune2 UTSW 19 16,977,400 (GRCm39) missense probably damaging 1.00
R2508:Prune2 UTSW 19 17,099,986 (GRCm39) missense probably benign 0.43
R3055:Prune2 UTSW 19 17,102,407 (GRCm39) missense probably damaging 0.98
R3086:Prune2 UTSW 19 17,098,777 (GRCm39) missense possibly damaging 0.75
R3104:Prune2 UTSW 19 17,096,520 (GRCm39) missense probably damaging 1.00
R3105:Prune2 UTSW 19 17,096,520 (GRCm39) missense probably damaging 1.00
R3547:Prune2 UTSW 19 17,101,712 (GRCm39) missense probably damaging 0.96
R3702:Prune2 UTSW 19 17,156,235 (GRCm39) missense probably damaging 1.00
R3753:Prune2 UTSW 19 17,102,818 (GRCm39) missense probably benign 0.38
R3933:Prune2 UTSW 19 17,101,318 (GRCm39) missense probably damaging 1.00
R3935:Prune2 UTSW 19 17,177,150 (GRCm39) missense probably damaging 1.00
R4022:Prune2 UTSW 19 16,977,384 (GRCm39) missense probably damaging 1.00
R4042:Prune2 UTSW 19 16,981,190 (GRCm39) critical splice donor site probably null
R4164:Prune2 UTSW 19 16,981,098 (GRCm39) missense possibly damaging 0.87
R4453:Prune2 UTSW 19 17,099,274 (GRCm39) missense probably benign 0.00
R4642:Prune2 UTSW 19 16,998,019 (GRCm39) critical splice donor site probably null
R4661:Prune2 UTSW 19 16,977,387 (GRCm39) missense probably damaging 1.00
R4666:Prune2 UTSW 19 17,097,552 (GRCm39) nonsense probably null
R4823:Prune2 UTSW 19 17,097,868 (GRCm39) missense probably damaging 1.00
R4897:Prune2 UTSW 19 17,099,219 (GRCm39) missense probably benign 0.03
R4922:Prune2 UTSW 19 17,100,116 (GRCm39) missense probably benign 0.00
R4962:Prune2 UTSW 19 17,099,637 (GRCm39) missense probably benign 0.11
R5026:Prune2 UTSW 19 17,176,506 (GRCm39) missense probably damaging 1.00
R5042:Prune2 UTSW 19 17,097,161 (GRCm39) missense possibly damaging 0.94
R5124:Prune2 UTSW 19 17,177,274 (GRCm39) missense probably damaging 1.00
R5133:Prune2 UTSW 19 16,980,995 (GRCm39) missense probably damaging 1.00
R5184:Prune2 UTSW 19 17,193,721 (GRCm39) missense possibly damaging 0.95
R5234:Prune2 UTSW 19 17,096,032 (GRCm39) missense probably damaging 1.00
R5339:Prune2 UTSW 19 17,098,236 (GRCm39) missense probably damaging 1.00
R5363:Prune2 UTSW 19 17,095,630 (GRCm39) missense probably damaging 1.00
R5382:Prune2 UTSW 19 16,981,023 (GRCm39) missense probably damaging 1.00
R5436:Prune2 UTSW 19 16,998,007 (GRCm39) missense probably damaging 1.00
R5480:Prune2 UTSW 19 17,098,311 (GRCm39) missense possibly damaging 0.66
R5635:Prune2 UTSW 19 17,095,573 (GRCm39) missense probably benign 0.19
R5678:Prune2 UTSW 19 17,096,032 (GRCm39) missense probably damaging 1.00
R5814:Prune2 UTSW 19 16,993,725 (GRCm39) splice site probably null
R5894:Prune2 UTSW 19 17,098,755 (GRCm39) missense possibly damaging 0.88
R6011:Prune2 UTSW 19 17,096,080 (GRCm39) missense probably benign 0.35
R6207:Prune2 UTSW 19 17,095,480 (GRCm39) missense probably damaging 1.00
R6218:Prune2 UTSW 19 17,098,926 (GRCm39) missense probably benign 0.00
R6573:Prune2 UTSW 19 17,098,521 (GRCm39) missense probably damaging 1.00
R6573:Prune2 UTSW 19 17,098,522 (GRCm39) missense possibly damaging 0.61
R6734:Prune2 UTSW 19 16,981,097 (GRCm39) missense probably damaging 1.00
R6805:Prune2 UTSW 19 17,097,954 (GRCm39) missense probably benign
R6837:Prune2 UTSW 19 17,156,292 (GRCm39) missense probably damaging 1.00
R6850:Prune2 UTSW 19 17,099,552 (GRCm39) missense probably benign 0.00
R6858:Prune2 UTSW 19 17,095,470 (GRCm39) missense possibly damaging 0.70
R6874:Prune2 UTSW 19 17,100,592 (GRCm39) missense probably damaging 1.00
R6954:Prune2 UTSW 19 16,977,385 (GRCm39) missense probably damaging 1.00
R7098:Prune2 UTSW 19 17,097,966 (GRCm39) missense probably benign 0.39
R7102:Prune2 UTSW 19 17,098,577 (GRCm39) missense probably benign 0.24
R7246:Prune2 UTSW 19 17,098,732 (GRCm39) missense probably damaging 0.99
R7284:Prune2 UTSW 19 17,097,250 (GRCm39) missense probably damaging 1.00
R7295:Prune2 UTSW 19 17,097,261 (GRCm39) missense probably benign 0.01
R7371:Prune2 UTSW 19 17,096,734 (GRCm39) missense probably benign 0.02
R7651:Prune2 UTSW 19 17,097,772 (GRCm39) missense probably damaging 1.00
R7830:Prune2 UTSW 19 17,100,038 (GRCm39) missense probably benign 0.21
R7872:Prune2 UTSW 19 17,096,798 (GRCm39) missense probably benign 0.05
R7881:Prune2 UTSW 19 17,100,393 (GRCm39) missense possibly damaging 0.50
R7966:Prune2 UTSW 19 17,156,223 (GRCm39) missense probably damaging 0.99
R8092:Prune2 UTSW 19 17,097,357 (GRCm39) missense probably damaging 1.00
R8110:Prune2 UTSW 19 17,098,083 (GRCm39) missense probably benign 0.22
R8115:Prune2 UTSW 19 17,101,288 (GRCm39) missense probably benign 0.02
R8129:Prune2 UTSW 19 17,096,200 (GRCm39) missense probably benign 0.01
R8169:Prune2 UTSW 19 17,102,455 (GRCm39) missense probably benign 0.10
R8171:Prune2 UTSW 19 17,097,882 (GRCm39) missense probably damaging 1.00
R8176:Prune2 UTSW 19 17,095,656 (GRCm39) missense probably damaging 1.00
R8200:Prune2 UTSW 19 17,102,337 (GRCm39) missense probably benign 0.01
R8217:Prune2 UTSW 19 17,097,480 (GRCm39) missense probably benign 0.01
R8258:Prune2 UTSW 19 17,189,672 (GRCm39) missense unknown
R8259:Prune2 UTSW 19 17,189,672 (GRCm39) missense unknown
R8289:Prune2 UTSW 19 17,100,373 (GRCm39) missense probably benign 0.43
R8329:Prune2 UTSW 19 17,098,629 (GRCm39) missense probably benign 0.02
R8342:Prune2 UTSW 19 17,103,027 (GRCm39) missense probably benign 0.01
R8558:Prune2 UTSW 19 17,099,602 (GRCm39) missense probably damaging 0.98
R8732:Prune2 UTSW 19 17,097,769 (GRCm39) missense probably damaging 1.00
R8743:Prune2 UTSW 19 17,096,920 (GRCm39) missense probably benign 0.22
R8769:Prune2 UTSW 19 17,100,442 (GRCm39) missense probably damaging 0.96
R8862:Prune2 UTSW 19 17,097,510 (GRCm39) missense probably benign 0.04
R8936:Prune2 UTSW 19 17,099,199 (GRCm39) missense probably benign 0.24
R9040:Prune2 UTSW 19 17,097,991 (GRCm39) missense probably damaging 1.00
R9084:Prune2 UTSW 19 17,097,741 (GRCm39) missense probably damaging 1.00
R9224:Prune2 UTSW 19 17,097,393 (GRCm39) missense probably damaging 1.00
R9273:Prune2 UTSW 19 17,095,690 (GRCm39) missense possibly damaging 0.74
R9275:Prune2 UTSW 19 17,101,144 (GRCm39) missense probably benign 0.06
R9278:Prune2 UTSW 19 17,101,144 (GRCm39) missense probably benign 0.06
R9290:Prune2 UTSW 19 17,145,691 (GRCm39) missense probably benign 0.41
R9305:Prune2 UTSW 19 17,097,625 (GRCm39) missense probably benign 0.14
R9317:Prune2 UTSW 19 17,099,034 (GRCm39) missense probably benign 0.00
R9354:Prune2 UTSW 19 17,099,986 (GRCm39) missense probably benign 0.43
R9373:Prune2 UTSW 19 17,099,502 (GRCm39) missense probably benign
R9394:Prune2 UTSW 19 16,981,053 (GRCm39) missense probably damaging 1.00
R9405:Prune2 UTSW 19 17,193,708 (GRCm39) missense probably damaging 0.99
R9476:Prune2 UTSW 19 17,096,706 (GRCm39) missense possibly damaging 0.64
R9532:Prune2 UTSW 19 17,099,794 (GRCm39) missense probably benign 0.00
X0019:Prune2 UTSW 19 17,098,881 (GRCm39) missense probably benign 0.16
X0028:Prune2 UTSW 19 17,100,249 (GRCm39) missense probably damaging 1.00
X0064:Prune2 UTSW 19 17,099,739 (GRCm39) missense probably damaging 1.00
X0066:Prune2 UTSW 19 17,096,154 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGCACACAGACATAGGATTG -3'
(R):5'- GCAGAGGTAAATTAAGTTTCCCTGG -3'

Sequencing Primer
(F):5'- TGCACACAGACATAGGATTGAGGAG -3'
(R):5'- CTCTGAAAAGACATCACGC -3'
Posted On 2020-09-15