Mutagenetix > Incidental Mutation

Incidental Mutation 'R7970:Slc9a2'

650531

Institutional Source

Beutler Lab

Gene Symbol

Slc9a2

Ensembl Gene

ENSMUSG00000026062

Gene Name

solute carrier family 9 (sodium/hydrogen exchanger), member 2

Synonyms

2210416H12Rik, 4932415O19Rik, NHE2

MMRRC Submission

046013-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.057) question?

Stock #

R7970 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

40680574-40769273 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 40726214 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 255 (Y255H)

Ref Sequence

ENSEMBL: ENSMUSP00000027231 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027231] [ENSMUST00000192345]

AlphaFold

Q3ZAS0

Predicted Effect

probably damaging
Transcript: ENSMUST00000027231
AA Change: Y255H

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000027231
Gene: ENSMUSG00000026062
AA Change: Y255H

Domain	Start	End	E-Value	Type
signal peptide	1	34	N/A	INTRINSIC
low complexity region	40	60	N/A	INTRINSIC
Pfam:Na_H_Exchanger	85	486	1.4e-95	PFAM
low complexity region	528	543	N/A	INTRINSIC
Pfam:NEXCaM_BD	576	685	3e-44	PFAM
low complexity region	738	753	N/A	INTRINSIC
low complexity region	788	793	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000192345
AA Change: Y255H

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000142144
Gene: ENSMUSG00000026062
AA Change: Y255H

Domain	Start	End	E-Value	Type
signal peptide	1	34	N/A	INTRINSIC
low complexity region	40	60	N/A	INTRINSIC
Pfam:Na_H_Exchanger	85	336	2.5e-56	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (57/57)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium-hydrogen exchanger (NHE) protein family. These proteins are involved in sodium-ion transport by exchanging intracellular hydrogen ions to external sodium ions and help in the regulation of cell pH and volume. The encoded protein is localized to the apical membrane and is involved in apical absorption of sodium. [provided by RefSeq, Jun 2016]
PHENOTYPE: Gastric acid secretion is impaired in homozygous mutant mice. The gastric mucosa becomes inflamed and exhibits an altered cellular composition. Mutant mice do not breed well. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010111I01Rik	A	G	13: 63,033,160	N312S	probably benign	Het
Acnat1	A	G	4: 49,449,266	F167L	probably damaging	Het
Acsbg2	A	G	17: 56,849,728	Y437H	probably benign	Het
Amotl2	C	T	9: 102,723,769	T345I	probably benign	Het
Anapc2	T	C	2: 25,273,287	S179P	possibly damaging	Het
Arhgef1	G	A	7: 24,916,881	D317N	probably damaging	Het
Arrdc4	G	A	7: 68,741,072	P307S	probably damaging	Het
B3gnt2	T	C	11: 22,836,255	Y311C	probably damaging	Het
Brf1	T	C	12: 112,964,200	D453G	probably damaging	Het
Clpsl2	G	A	17: 28,550,728	G55R	probably damaging	Het
Dao	AGG	AG	5: 114,015,209		probably benign	Het
Dst	G	T	1: 34,182,747	C2544F	possibly damaging	Het
Efhc1	C	T	1: 20,951,795	T21M	probably benign	Het
Efs	A	G	14: 54,920,503		probably null	Het
Evl	C	T	12: 108,681,524	R295*	probably null	Het
Fam171a2	A	T	11: 102,437,866	V689E	possibly damaging	Het
Fam184a	T	C	10: 53,699,325	T63A	probably damaging	Het
Fam186a	T	C	15: 99,933,586	D2897G	unknown	Het
Fbxw11	T	G	11: 32,722,101	S224A	probably benign	Het
Flnc	G	T	6: 29,447,526	E1109D	possibly damaging	Het
Foxn4	A	G	5: 114,263,007		probably null	Het
Gm19410	A	G	8: 35,815,647	E2009G	probably benign	Het
Gm9958	A	G	5: 90,367,709		probably benign	Het
Gprin3	C	T	6: 59,353,165	R719Q	possibly damaging	Het
Grip2	A	T	6: 91,786,532	I147N	probably benign	Het
H2-DMb2	A	G	17: 34,150,598	R239G	probably benign	Het
Hydin	A	C	8: 110,309,091	D138A	probably damaging	Het
Ikbkap	A	T	4: 56,771,466	Y944N	probably damaging	Het
Kctd17	CAGCTGGAGGAGC	CAGC	15: 78,436,913		probably benign	Het
Lgr6	A	G	1: 134,993,985	I484T	probably benign	Het
Mkrn2	T	A	6: 115,617,308	C327S	probably damaging	Het
Mnt	C	T	11: 74,842,210	A288V	probably damaging	Het
Nckap5	T	A	1: 126,025,021	K1265*	probably null	Het
Ncoa3	A	T	2: 166,051,357	H194L	probably benign	Het
Ogn	A	T	13: 49,609,266	H28L	probably benign	Het
Olfr1160	A	T	2: 88,005,825	F309I	probably benign	Het
Olfr1453	T	A	19: 13,027,694	I212F	probably damaging	Het
Olfr680-ps1	C	A	7: 105,091,349	V97L	probably benign	Het
Pclo	T	C	5: 14,714,478	S1037P		Het
Phlpp1	T	A	1: 106,173,285	Y428N	probably damaging	Het
Ptpre	A	G	7: 135,678,319	T591A	possibly damaging	Het
Rtn1	A	T	12: 72,308,874	D99E	probably benign	Het
Scn7a	A	T	2: 66,675,829	I1572N	probably damaging	Het
Sema3a	T	A	5: 13,599,407	M708K	possibly damaging	Het
Slc12a4	G	A	8: 105,951,605	R319W	possibly damaging	Het
Spock3	T	C	8: 63,345,715	F254L	probably damaging	Het
St6gal1	G	A	16: 23,357,835	A393T	probably benign	Het
St6galnac2	T	C	11: 116,690,343	D51G	probably benign	Het
Stard13	T	A	5: 151,063,261	K261N	possibly damaging	Het
Tlk1	T	C	2: 70,752,300	R162G	possibly damaging	Het
Tlr2	T	C	3: 83,837,894	D294G	probably benign	Het
Tnks	A	G	8: 34,855,926		probably null	Het
Trip4	A	G	9: 65,839,016	S533P	probably damaging	Het
Ttc3	T	A	16: 94,457,364	W1674R	probably damaging	Het
Vmn2r114	T	C	17: 23,311,212	N74D	probably benign	Het
Zcchc11	G	A	4: 108,486,454	S221N	probably benign	Het
Zdbf2	T	C	1: 63,304,171	Y570H	possibly damaging	Het

Other mutations in Slc9a2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00229:Slc9a2	APN	1	40767737	missense	probably benign
IGL00487:Slc9a2	APN	1	40742658	missense	probably damaging	0.99
IGL00500:Slc9a2	APN	1	40763583	missense	possibly damaging	0.95
IGL01445:Slc9a2	APN	1	40718810	missense	possibly damaging	0.51
IGL02060:Slc9a2	APN	1	40756293	missense	probably damaging	0.99
IGL02813:Slc9a2	APN	1	40742669	missense	probably damaging	1.00
IGL02894:Slc9a2	APN	1	40763602	missense	probably benign	0.20
IGL02939:Slc9a2	APN	1	40742703	missense	probably damaging	1.00
IGL03193:Slc9a2	APN	1	40756271	missense	probably benign	0.00
putty	UTSW	1	40742653	nonsense	probably null
E0370:Slc9a2	UTSW	1	40763541	critical splice acceptor site	probably null
PIT4377001:Slc9a2	UTSW	1	40743841	missense	probably damaging	1.00
R0009:Slc9a2	UTSW	1	40763602	missense	probably benign	0.38
R0009:Slc9a2	UTSW	1	40763602	missense	probably benign	0.38
R0152:Slc9a2	UTSW	1	40742804	missense	probably damaging	1.00
R0374:Slc9a2	UTSW	1	40743857	missense	possibly damaging	0.93
R1386:Slc9a2	UTSW	1	40719018	missense	probably damaging	1.00
R1485:Slc9a2	UTSW	1	40726388	missense	probably damaging	1.00
R1712:Slc9a2	UTSW	1	40763610	missense	possibly damaging	0.90
R1779:Slc9a2	UTSW	1	40742643	missense	probably damaging	0.99
R2051:Slc9a2	UTSW	1	40726437	missense	probably damaging	1.00
R2166:Slc9a2	UTSW	1	40742768	missense	probably damaging	1.00
R2513:Slc9a2	UTSW	1	40742608	splice site	probably null
R3612:Slc9a2	UTSW	1	40719058	splice site	probably null
R4631:Slc9a2	UTSW	1	40761918	missense	possibly damaging	0.66
R4760:Slc9a2	UTSW	1	40761916	missense	probably damaging	1.00
R4768:Slc9a2	UTSW	1	40726374	missense	probably damaging	1.00
R4769:Slc9a2	UTSW	1	40726374	missense	probably damaging	1.00
R4815:Slc9a2	UTSW	1	40718849	missense	probably benign	0.00
R4920:Slc9a2	UTSW	1	40755718	missense	probably benign	0.05
R5191:Slc9a2	UTSW	1	40743893	missense	probably damaging	1.00
R5963:Slc9a2	UTSW	1	40682036	missense	possibly damaging	0.94
R6322:Slc9a2	UTSW	1	40742653	nonsense	probably null
R6453:Slc9a2	UTSW	1	40742621	missense	possibly damaging	0.64
R6685:Slc9a2	UTSW	1	40718909	missense	probably damaging	0.99
R7088:Slc9a2	UTSW	1	40726379	missense	probably damaging	1.00
R7302:Slc9a2	UTSW	1	40767668	missense	possibly damaging	0.58
R7450:Slc9a2	UTSW	1	40681835	start gained	probably benign
R7670:Slc9a2	UTSW	1	40718997	missense	probably damaging	1.00
R8104:Slc9a2	UTSW	1	40718649	missense	probably damaging	1.00
R8776:Slc9a2	UTSW	1	40742729	missense	probably damaging	1.00
R8776-TAIL:Slc9a2	UTSW	1	40742729	missense	probably damaging	1.00
R8887:Slc9a2	UTSW	1	40718849	missense	probably benign	0.01
R9028:Slc9a2	UTSW	1	40726452	missense	probably damaging	1.00
R9189:Slc9a2	UTSW	1	40755784	missense	probably benign	0.21
R9245:Slc9a2	UTSW	1	40766300	missense	probably benign	0.27
R9250:Slc9a2	UTSW	1	40767827	missense	probably benign	0.00
R9400:Slc9a2	UTSW	1	40719051	missense	possibly damaging	0.65
R9512:Slc9a2	UTSW	1	40682098	missense	probably damaging	0.98
R9583:Slc9a2	UTSW	1	40681901	missense	probably benign
X0054:Slc9a2	UTSW	1	40742687	missense	probably damaging	0.99
Z1176:Slc9a2	UTSW	1	40767711	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCAAGGTGATCATAGGCAAAACTAG -3'
(R):5'- GCTCAATGACCCGGATGTTG -3'

Sequencing Primer
(F):5'- ACCCAGCGTTTGATAATGGC -3'
(R):5'- ACCCGGATGTTGTGTGTGAAAC -3'

Posted On

2020-09-15