Incidental Mutation 'R7970:Slc9a2'
ID650531
Institutional Source Beutler Lab
Gene Symbol Slc9a2
Ensembl Gene ENSMUSG00000026062
Gene Namesolute carrier family 9 (sodium/hydrogen exchanger), member 2
Synonyms2210416H12Rik, 4932415O19Rik, NHE2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R7970 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location40680574-40769273 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 40726214 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 255 (Y255H)
Ref Sequence ENSEMBL: ENSMUSP00000027231 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027231] [ENSMUST00000192345]
Predicted Effect probably damaging
Transcript: ENSMUST00000027231
AA Change: Y255H

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000027231
Gene: ENSMUSG00000026062
AA Change: Y255H

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
low complexity region 40 60 N/A INTRINSIC
Pfam:Na_H_Exchanger 85 486 1.4e-95 PFAM
low complexity region 528 543 N/A INTRINSIC
Pfam:NEXCaM_BD 576 685 3e-44 PFAM
low complexity region 738 753 N/A INTRINSIC
low complexity region 788 793 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000192345
AA Change: Y255H

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000142144
Gene: ENSMUSG00000026062
AA Change: Y255H

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
low complexity region 40 60 N/A INTRINSIC
Pfam:Na_H_Exchanger 85 336 2.5e-56 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium-hydrogen exchanger (NHE) protein family. These proteins are involved in sodium-ion transport by exchanging intracellular hydrogen ions to external sodium ions and help in the regulation of cell pH and volume. The encoded protein is localized to the apical membrane and is involved in apical absorption of sodium. [provided by RefSeq, Jun 2016]
PHENOTYPE: Gastric acid secretion is impaired in homozygous mutant mice. The gastric mucosa becomes inflamed and exhibits an altered cellular composition. Mutant mice do not breed well. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik A G 13: 63,033,160 N312S probably benign Het
Acnat1 A G 4: 49,449,266 F167L probably damaging Het
Acsbg2 A G 17: 56,849,728 Y437H probably benign Het
Amotl2 C T 9: 102,723,769 T345I probably benign Het
Anapc2 T C 2: 25,273,287 S179P possibly damaging Het
Arhgef1 G A 7: 24,916,881 D317N probably damaging Het
Arrdc4 G A 7: 68,741,072 P307S probably damaging Het
B3gnt2 T C 11: 22,836,255 Y311C probably damaging Het
Brf1 T C 12: 112,964,200 D453G probably damaging Het
Clpsl2 G A 17: 28,550,728 G55R probably damaging Het
Dao AGG AG 5: 114,015,209 probably benign Het
Dst G T 1: 34,182,747 C2544F possibly damaging Het
Efhc1 C T 1: 20,951,795 T21M probably benign Het
Efs A G 14: 54,920,503 probably null Het
Evl C T 12: 108,681,524 R295* probably null Het
Fam171a2 A T 11: 102,437,866 V689E possibly damaging Het
Fam184a T C 10: 53,699,325 T63A probably damaging Het
Fam186a T C 15: 99,933,586 D2897G unknown Het
Fbxw11 T G 11: 32,722,101 S224A probably benign Het
Flnc G T 6: 29,447,526 E1109D possibly damaging Het
Foxn4 A G 5: 114,263,007 probably null Het
Gm19410 A G 8: 35,815,647 E2009G probably benign Het
Gm9958 A G 5: 90,367,709 probably benign Het
Gprin3 C T 6: 59,353,165 R719Q possibly damaging Het
Grip2 A T 6: 91,786,532 I147N probably benign Het
H2-DMb2 A G 17: 34,150,598 R239G probably benign Het
Hydin A C 8: 110,309,091 D138A probably damaging Het
Ikbkap A T 4: 56,771,466 Y944N probably damaging Het
Kctd17 CAGCTGGAGGAGC CAGC 15: 78,436,913 probably benign Het
Lgr6 A G 1: 134,993,985 I484T probably benign Het
Mkrn2 T A 6: 115,617,308 C327S probably damaging Het
Mnt C T 11: 74,842,210 A288V probably damaging Het
Nckap5 T A 1: 126,025,021 K1265* probably null Het
Ncoa3 A T 2: 166,051,357 H194L probably benign Het
Ogn A T 13: 49,609,266 H28L probably benign Het
Olfr1160 A T 2: 88,005,825 F309I probably benign Het
Olfr1453 T A 19: 13,027,694 I212F probably damaging Het
Olfr680-ps1 C A 7: 105,091,349 V97L probably benign Het
Pclo T C 5: 14,714,478 S1037P Het
Phlpp1 T A 1: 106,173,285 Y428N probably damaging Het
Ptpre A G 7: 135,678,319 T591A possibly damaging Het
Rtn1 A T 12: 72,308,874 D99E probably benign Het
Scn7a A T 2: 66,675,829 I1572N probably damaging Het
Sema3a T A 5: 13,599,407 M708K possibly damaging Het
Slc12a4 G A 8: 105,951,605 R319W possibly damaging Het
Spock3 T C 8: 63,345,715 F254L probably damaging Het
St6gal1 G A 16: 23,357,835 A393T probably benign Het
St6galnac2 T C 11: 116,690,343 D51G probably benign Het
Stard13 T A 5: 151,063,261 K261N possibly damaging Het
Tlk1 T C 2: 70,752,300 R162G possibly damaging Het
Tlr2 T C 3: 83,837,894 D294G probably benign Het
Tnks A G 8: 34,855,926 probably null Het
Trip4 A G 9: 65,839,016 S533P probably damaging Het
Ttc3 T A 16: 94,457,364 W1674R probably damaging Het
Vmn2r114 T C 17: 23,311,212 N74D probably benign Het
Zcchc11 G A 4: 108,486,454 S221N probably benign Het
Zdbf2 T C 1: 63,304,171 Y570H possibly damaging Het
Other mutations in Slc9a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Slc9a2 APN 1 40767737 missense probably benign
IGL00487:Slc9a2 APN 1 40742658 missense probably damaging 0.99
IGL00500:Slc9a2 APN 1 40763583 missense possibly damaging 0.95
IGL01445:Slc9a2 APN 1 40718810 missense possibly damaging 0.51
IGL02060:Slc9a2 APN 1 40756293 missense probably damaging 0.99
IGL02813:Slc9a2 APN 1 40742669 missense probably damaging 1.00
IGL02894:Slc9a2 APN 1 40763602 missense probably benign 0.20
IGL02939:Slc9a2 APN 1 40742703 missense probably damaging 1.00
IGL03193:Slc9a2 APN 1 40756271 missense probably benign 0.00
E0370:Slc9a2 UTSW 1 40763541 critical splice acceptor site probably null
PIT4377001:Slc9a2 UTSW 1 40743841 missense probably damaging 1.00
R0009:Slc9a2 UTSW 1 40763602 missense probably benign 0.38
R0009:Slc9a2 UTSW 1 40763602 missense probably benign 0.38
R0152:Slc9a2 UTSW 1 40742804 missense probably damaging 1.00
R0374:Slc9a2 UTSW 1 40743857 missense possibly damaging 0.93
R1386:Slc9a2 UTSW 1 40719018 missense probably damaging 1.00
R1485:Slc9a2 UTSW 1 40726388 missense probably damaging 1.00
R1712:Slc9a2 UTSW 1 40763610 missense possibly damaging 0.90
R1779:Slc9a2 UTSW 1 40742643 missense probably damaging 0.99
R2051:Slc9a2 UTSW 1 40726437 missense probably damaging 1.00
R2166:Slc9a2 UTSW 1 40742768 missense probably damaging 1.00
R2513:Slc9a2 UTSW 1 40742608 splice site probably null
R3612:Slc9a2 UTSW 1 40719058 splice site probably null
R4631:Slc9a2 UTSW 1 40761918 missense possibly damaging 0.66
R4760:Slc9a2 UTSW 1 40761916 missense probably damaging 1.00
R4768:Slc9a2 UTSW 1 40726374 missense probably damaging 1.00
R4769:Slc9a2 UTSW 1 40726374 missense probably damaging 1.00
R4815:Slc9a2 UTSW 1 40718849 missense probably benign 0.00
R4920:Slc9a2 UTSW 1 40755718 missense probably benign 0.05
R5191:Slc9a2 UTSW 1 40743893 missense probably damaging 1.00
R5963:Slc9a2 UTSW 1 40682036 missense possibly damaging 0.94
R6322:Slc9a2 UTSW 1 40742653 nonsense probably null
R6453:Slc9a2 UTSW 1 40742621 missense possibly damaging 0.64
R6685:Slc9a2 UTSW 1 40718909 missense probably damaging 0.99
R7088:Slc9a2 UTSW 1 40726379 missense probably damaging 1.00
R7302:Slc9a2 UTSW 1 40767668 missense possibly damaging 0.58
R7450:Slc9a2 UTSW 1 40681835 start gained probably benign
R7670:Slc9a2 UTSW 1 40718997 missense probably damaging 1.00
R8104:Slc9a2 UTSW 1 40718649 missense probably damaging 1.00
R8776:Slc9a2 UTSW 1 40742729 missense probably damaging 1.00
R8776-TAIL:Slc9a2 UTSW 1 40742729 missense probably damaging 1.00
X0054:Slc9a2 UTSW 1 40742687 missense probably damaging 0.99
Z1176:Slc9a2 UTSW 1 40767711 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAAGGTGATCATAGGCAAAACTAG -3'
(R):5'- GCTCAATGACCCGGATGTTG -3'

Sequencing Primer
(F):5'- ACCCAGCGTTTGATAATGGC -3'
(R):5'- ACCCGGATGTTGTGTGTGAAAC -3'
Posted On2020-09-15