Incidental Mutation 'R7970:Nckap5'
ID650534
Institutional Source Beutler Lab
Gene Symbol Nckap5
Ensembl Gene ENSMUSG00000049690
Gene NameNCK-associated protein 5
SynonymsE030049G20Rik, LOC380609, D130011D22Rik
MMRRC Submission
Accession Numbers

Genbank: NM_001081756, NM_172484, NM_176957

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7970 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location125913620-126830799 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 126025021 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 1265 (K1265*)
Ref Sequence ENSEMBL: ENSMUSP00000125624 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057846] [ENSMUST00000094609] [ENSMUST00000094610] [ENSMUST00000112583] [ENSMUST00000161954] [ENSMUST00000162877]
Predicted Effect probably null
Transcript: ENSMUST00000057846
AA Change: K1201*
SMART Domains Protein: ENSMUSP00000062229
Gene: ENSMUSG00000049690
AA Change: K1201*

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
coiled coil region 108 186 N/A INTRINSIC
low complexity region 321 332 N/A INTRINSIC
low complexity region 755 771 N/A INTRINSIC
low complexity region 950 971 N/A INTRINSIC
low complexity region 1070 1085 N/A INTRINSIC
low complexity region 1181 1200 N/A INTRINSIC
Pfam:NCKAP5 1298 1602 1.8e-120 PFAM
low complexity region 1728 1742 N/A INTRINSIC
low complexity region 1757 1771 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000094609
SMART Domains Protein: ENSMUSP00000092192
Gene: ENSMUSG00000049690

DomainStartEndE-ValueType
low complexity region 70 93 N/A INTRINSIC
Pfam:NCKAP5 113 364 3.6e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000094610
SMART Domains Protein: ENSMUSP00000092193
Gene: ENSMUSG00000049690

DomainStartEndE-ValueType
Pfam:NCKAP5 1 101 8.8e-42 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000112583
AA Change: K1333*
SMART Domains Protein: ENSMUSP00000108202
Gene: ENSMUSG00000049690
AA Change: K1333*

DomainStartEndE-ValueType
low complexity region 70 93 N/A INTRINSIC
coiled coil region 176 254 N/A INTRINSIC
low complexity region 301 324 N/A INTRINSIC
low complexity region 453 464 N/A INTRINSIC
low complexity region 887 903 N/A INTRINSIC
low complexity region 1082 1103 N/A INTRINSIC
low complexity region 1202 1217 N/A INTRINSIC
low complexity region 1313 1332 N/A INTRINSIC
Pfam:NCKAP5 1431 1733 5.3e-119 PFAM
low complexity region 1860 1874 N/A INTRINSIC
low complexity region 1889 1903 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000161954
AA Change: K1265*
SMART Domains Protein: ENSMUSP00000125624
Gene: ENSMUSG00000049690
AA Change: K1265*

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
coiled coil region 108 186 N/A INTRINSIC
low complexity region 233 256 N/A INTRINSIC
low complexity region 385 396 N/A INTRINSIC
low complexity region 819 835 N/A INTRINSIC
low complexity region 1014 1035 N/A INTRINSIC
low complexity region 1134 1149 N/A INTRINSIC
low complexity region 1245 1264 N/A INTRINSIC
Pfam:NCKAP5 1362 1666 2.1e-120 PFAM
low complexity region 1792 1806 N/A INTRINSIC
low complexity region 1821 1835 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162877
SMART Domains Protein: ENSMUSP00000124748
Gene: ENSMUSG00000049690

DomainStartEndE-ValueType
Pfam:NCKAP5 9 296 6e-36 PFAM
Meta Mutation Damage Score 0.9756 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (57/57)
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik A G 13: 63,033,160 N312S probably benign Het
Acnat1 A G 4: 49,449,266 F167L probably damaging Het
Acsbg2 A G 17: 56,849,728 Y437H probably benign Het
Amotl2 C T 9: 102,723,769 T345I probably benign Het
Anapc2 T C 2: 25,273,287 S179P possibly damaging Het
Arhgef1 G A 7: 24,916,881 D317N probably damaging Het
Arrdc4 G A 7: 68,741,072 P307S probably damaging Het
B3gnt2 T C 11: 22,836,255 Y311C probably damaging Het
Brf1 T C 12: 112,964,200 D453G probably damaging Het
Clpsl2 G A 17: 28,550,728 G55R probably damaging Het
Dao AGG AG 5: 114,015,209 probably benign Het
Dst G T 1: 34,182,747 C2544F possibly damaging Het
Efhc1 C T 1: 20,951,795 T21M probably benign Het
Efs A G 14: 54,920,503 probably null Het
Evl C T 12: 108,681,524 R295* probably null Het
Fam171a2 A T 11: 102,437,866 V689E possibly damaging Het
Fam184a T C 10: 53,699,325 T63A probably damaging Het
Fam186a T C 15: 99,933,586 D2897G unknown Het
Fbxw11 T G 11: 32,722,101 S224A probably benign Het
Flnc G T 6: 29,447,526 E1109D possibly damaging Het
Foxn4 A G 5: 114,263,007 probably null Het
Gm19410 A G 8: 35,815,647 E2009G probably benign Het
Gm9958 A G 5: 90,367,709 probably benign Het
Gprin3 C T 6: 59,353,165 R719Q possibly damaging Het
Grip2 A T 6: 91,786,532 I147N probably benign Het
H2-DMb2 A G 17: 34,150,598 R239G probably benign Het
Hydin A C 8: 110,309,091 D138A probably damaging Het
Ikbkap A T 4: 56,771,466 Y944N probably damaging Het
Kctd17 CAGCTGGAGGAGC CAGC 15: 78,436,913 probably benign Het
Lgr6 A G 1: 134,993,985 I484T probably benign Het
Mkrn2 T A 6: 115,617,308 C327S probably damaging Het
Mnt C T 11: 74,842,210 A288V probably damaging Het
Ncoa3 A T 2: 166,051,357 H194L probably benign Het
Ogn A T 13: 49,609,266 H28L probably benign Het
Olfr1160 A T 2: 88,005,825 F309I probably benign Het
Olfr1453 T A 19: 13,027,694 I212F probably damaging Het
Olfr680-ps1 C A 7: 105,091,349 V97L probably benign Het
Pclo T C 5: 14,714,478 S1037P Het
Phlpp1 T A 1: 106,173,285 Y428N probably damaging Het
Ptpre A G 7: 135,678,319 T591A possibly damaging Het
Rtn1 A T 12: 72,308,874 D99E probably benign Het
Scn7a A T 2: 66,675,829 I1572N probably damaging Het
Sema3a T A 5: 13,599,407 M708K possibly damaging Het
Slc12a4 G A 8: 105,951,605 R319W possibly damaging Het
Slc9a2 T C 1: 40,726,214 Y255H probably damaging Het
Spock3 T C 8: 63,345,715 F254L probably damaging Het
St6gal1 G A 16: 23,357,835 A393T probably benign Het
St6galnac2 T C 11: 116,690,343 D51G probably benign Het
Stard13 T A 5: 151,063,261 K261N possibly damaging Het
Tlk1 T C 2: 70,752,300 R162G possibly damaging Het
Tlr2 T C 3: 83,837,894 D294G probably benign Het
Tnks A G 8: 34,855,926 probably null Het
Trip4 A G 9: 65,839,016 S533P probably damaging Het
Ttc3 T A 16: 94,457,364 W1674R probably damaging Het
Vmn2r114 T C 17: 23,311,212 N74D probably benign Het
Zcchc11 G A 4: 108,486,454 S221N probably benign Het
Zdbf2 T C 1: 63,304,171 Y570H possibly damaging Het
Other mutations in Nckap5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00833:Nckap5 APN 1 126027152 missense probably damaging 0.99
IGL00956:Nckap5 APN 1 126025018 missense probably damaging 0.98
IGL01414:Nckap5 APN 1 126528713 missense probably damaging 1.00
IGL01482:Nckap5 APN 1 126023160 missense probably damaging 1.00
IGL01508:Nckap5 APN 1 126025572 missense probably damaging 0.96
IGL02071:Nckap5 APN 1 125981568 missense probably damaging 0.97
IGL02129:Nckap5 APN 1 126027695 nonsense probably null
IGL02821:Nckap5 APN 1 126027816 missense probably damaging 1.00
IGL03174:Nckap5 APN 1 125981646 missense probably damaging 1.00
F5493:Nckap5 UTSW 1 126025827 missense probably benign
G5030:Nckap5 UTSW 1 126025854 missense probably damaging 0.96
R0033:Nckap5 UTSW 1 125940242 intron probably benign
R0164:Nckap5 UTSW 1 126024407 missense possibly damaging 0.84
R0164:Nckap5 UTSW 1 126024407 missense possibly damaging 0.84
R0349:Nckap5 UTSW 1 126026434 missense probably benign
R0482:Nckap5 UTSW 1 126026365 missense possibly damaging 0.92
R0508:Nckap5 UTSW 1 125981384 splice site probably null
R0541:Nckap5 UTSW 1 126695722 missense possibly damaging 0.82
R0609:Nckap5 UTSW 1 126027288 nonsense probably null
R0701:Nckap5 UTSW 1 126025357 missense probably benign 0.06
R0782:Nckap5 UTSW 1 125981541 missense probably damaging 1.00
R1389:Nckap5 UTSW 1 126026710 missense probably damaging 0.99
R1401:Nckap5 UTSW 1 126014661 splice site probably benign
R1436:Nckap5 UTSW 1 126026061 missense possibly damaging 0.96
R1506:Nckap5 UTSW 1 126025913 nonsense probably null
R1528:Nckap5 UTSW 1 126024922 missense possibly damaging 0.68
R1942:Nckap5 UTSW 1 126024302 missense probably damaging 1.00
R1968:Nckap5 UTSW 1 126014630 missense probably damaging 0.99
R2055:Nckap5 UTSW 1 126026898 missense probably damaging 1.00
R2105:Nckap5 UTSW 1 126026518 missense probably damaging 1.00
R2214:Nckap5 UTSW 1 126025750 missense possibly damaging 0.77
R2311:Nckap5 UTSW 1 126528752 missense probably damaging 1.00
R2403:Nckap5 UTSW 1 126027409 missense probably benign 0.18
R2430:Nckap5 UTSW 1 125914757 missense probably damaging 0.99
R2914:Nckap5 UTSW 1 126026537 splice site probably null
R3782:Nckap5 UTSW 1 126025074 missense possibly damaging 0.93
R4133:Nckap5 UTSW 1 126222706 missense probably benign 0.13
R4249:Nckap5 UTSW 1 126027639 missense probably benign 0.01
R4448:Nckap5 UTSW 1 126025726 nonsense probably null
R4456:Nckap5 UTSW 1 125914735 unclassified probably benign
R4682:Nckap5 UTSW 1 126102542 critical splice donor site probably null
R4817:Nckap5 UTSW 1 126027215 missense possibly damaging 0.68
R4907:Nckap5 UTSW 1 126026152 missense possibly damaging 0.92
R4908:Nckap5 UTSW 1 126027587 missense probably damaging 1.00
R4924:Nckap5 UTSW 1 126027028 nonsense probably null
R4926:Nckap5 UTSW 1 126528641 intron probably benign
R5032:Nckap5 UTSW 1 125977049 missense possibly damaging 0.62
R5133:Nckap5 UTSW 1 126033960 missense probably benign 0.01
R5197:Nckap5 UTSW 1 126222673 missense possibly damaging 0.79
R5238:Nckap5 UTSW 1 126027724 missense probably damaging 0.96
R5257:Nckap5 UTSW 1 126024508 missense probably damaging 0.99
R5277:Nckap5 UTSW 1 126026540 nonsense probably null
R5512:Nckap5 UTSW 1 126027744 missense possibly damaging 0.63
R5700:Nckap5 UTSW 1 125976925 critical splice donor site probably null
R5789:Nckap5 UTSW 1 126027702 missense probably damaging 1.00
R6029:Nckap5 UTSW 1 126025786 missense possibly damaging 0.89
R6249:Nckap5 UTSW 1 126024930 missense probably benign
R6292:Nckap5 UTSW 1 125915015 missense probably damaging 0.99
R6521:Nckap5 UTSW 1 126382172 missense probably damaging 1.00
R6875:Nckap5 UTSW 1 126023194 missense probably benign 0.03
R7017:Nckap5 UTSW 1 126102661 missense probably damaging 1.00
R7018:Nckap5 UTSW 1 126025048 missense probably damaging 0.99
R7054:Nckap5 UTSW 1 126258712 splice site probably null
R7204:Nckap5 UTSW 1 126026367 missense probably benign
R7336:Nckap5 UTSW 1 126026049 missense probably benign 0.00
R7544:Nckap5 UTSW 1 126026211 missense possibly damaging 0.92
R7590:Nckap5 UTSW 1 126026533 missense probably benign 0.00
R7684:Nckap5 UTSW 1 126026857 missense probably benign 0.00
R7749:Nckap5 UTSW 1 126024646 missense probably damaging 1.00
R7773:Nckap5 UTSW 1 126026844 missense probably benign 0.00
R7813:Nckap5 UTSW 1 126025426 missense probably benign 0.10
R7992:Nckap5 UTSW 1 126026810 missense probably damaging 0.99
R8278:Nckap5 UTSW 1 126027772 missense probably damaging 1.00
R8373:Nckap5 UTSW 1 126026295 missense probably benign 0.02
R8414:Nckap5 UTSW 1 126014620 missense probably damaging 1.00
Z1088:Nckap5 UTSW 1 126024832 missense possibly damaging 0.76
Z1176:Nckap5 UTSW 1 126528681 critical splice donor site probably null
Z1177:Nckap5 UTSW 1 126222659 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GATATCCCACTTGTTTCCAAATTGC -3'
(R):5'- GCCAGGCAAGATTCGAACTC -3'

Sequencing Primer
(F):5'- CAAATTGCTTGGGCGCTGC -3'
(R):5'- CAGGCAAGATTCGAACTCAGATTATC -3'
Posted On2020-09-15