Incidental Mutation 'R7970:Tlk1'
ID650538
Institutional Source Beutler Lab
Gene Symbol Tlk1
Ensembl Gene ENSMUSG00000041997
Gene Nametousled-like kinase 1
Synonyms4930545J15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7970 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location70712407-70825728 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 70752300 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 162 (R162G)
Ref Sequence ENSEMBL: ENSMUSP00000035961 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038584]
Predicted Effect possibly damaging
Transcript: ENSMUST00000038584
AA Change: R162G

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000035961
Gene: ENSMUSG00000041997
AA Change: R162G

DomainStartEndE-ValueType
low complexity region 20 33 N/A INTRINSIC
low complexity region 68 85 N/A INTRINSIC
low complexity region 170 192 N/A INTRINSIC
coiled coil region 248 277 N/A INTRINSIC
coiled coil region 403 441 N/A INTRINSIC
S_TKc 456 734 4.41e-75 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a serine/threonine kinase that may be involved in the regulation of chromatin assembly. The encoded protein is only active when it is phosphorylated, and this phosphorylation is cell cycle-dependent, with the maximal activity of this protein coming during S phase. The catalytic activity of this protein is diminished by DNA damage and by blockage of DNA replication. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik A G 13: 63,033,160 N312S probably benign Het
Acnat1 A G 4: 49,449,266 F167L probably damaging Het
Acsbg2 A G 17: 56,849,728 Y437H probably benign Het
Amotl2 C T 9: 102,723,769 T345I probably benign Het
Anapc2 T C 2: 25,273,287 S179P possibly damaging Het
Arhgef1 G A 7: 24,916,881 D317N probably damaging Het
Arrdc4 G A 7: 68,741,072 P307S probably damaging Het
B3gnt2 T C 11: 22,836,255 Y311C probably damaging Het
Brf1 T C 12: 112,964,200 D453G probably damaging Het
Clpsl2 G A 17: 28,550,728 G55R probably damaging Het
Dao AGG AG 5: 114,015,209 probably benign Het
Dst G T 1: 34,182,747 C2544F possibly damaging Het
Efhc1 C T 1: 20,951,795 T21M probably benign Het
Efs A G 14: 54,920,503 probably null Het
Evl C T 12: 108,681,524 R295* probably null Het
Fam171a2 A T 11: 102,437,866 V689E possibly damaging Het
Fam184a T C 10: 53,699,325 T63A probably damaging Het
Fam186a T C 15: 99,933,586 D2897G unknown Het
Fbxw11 T G 11: 32,722,101 S224A probably benign Het
Flnc G T 6: 29,447,526 E1109D possibly damaging Het
Foxn4 A G 5: 114,263,007 probably null Het
Gm19410 A G 8: 35,815,647 E2009G probably benign Het
Gm9958 A G 5: 90,367,709 probably benign Het
Gprin3 C T 6: 59,353,165 R719Q possibly damaging Het
Grip2 A T 6: 91,786,532 I147N probably benign Het
H2-DMb2 A G 17: 34,150,598 R239G probably benign Het
Hydin A C 8: 110,309,091 D138A probably damaging Het
Ikbkap A T 4: 56,771,466 Y944N probably damaging Het
Kctd17 CAGCTGGAGGAGC CAGC 15: 78,436,913 probably benign Het
Lgr6 A G 1: 134,993,985 I484T probably benign Het
Mkrn2 T A 6: 115,617,308 C327S probably damaging Het
Mnt C T 11: 74,842,210 A288V probably damaging Het
Nckap5 T A 1: 126,025,021 K1265* probably null Het
Ncoa3 A T 2: 166,051,357 H194L probably benign Het
Ogn A T 13: 49,609,266 H28L probably benign Het
Olfr1160 A T 2: 88,005,825 F309I probably benign Het
Olfr1453 T A 19: 13,027,694 I212F probably damaging Het
Olfr680-ps1 C A 7: 105,091,349 V97L probably benign Het
Pclo T C 5: 14,714,478 S1037P Het
Phlpp1 T A 1: 106,173,285 Y428N probably damaging Het
Ptpre A G 7: 135,678,319 T591A possibly damaging Het
Rtn1 A T 12: 72,308,874 D99E probably benign Het
Scn7a A T 2: 66,675,829 I1572N probably damaging Het
Sema3a T A 5: 13,599,407 M708K possibly damaging Het
Slc12a4 G A 8: 105,951,605 R319W possibly damaging Het
Slc9a2 T C 1: 40,726,214 Y255H probably damaging Het
Spock3 T C 8: 63,345,715 F254L probably damaging Het
St6gal1 G A 16: 23,357,835 A393T probably benign Het
St6galnac2 T C 11: 116,690,343 D51G probably benign Het
Stard13 T A 5: 151,063,261 K261N possibly damaging Het
Tlr2 T C 3: 83,837,894 D294G probably benign Het
Tnks A G 8: 34,855,926 probably null Het
Trip4 A G 9: 65,839,016 S533P probably damaging Het
Ttc3 T A 16: 94,457,364 W1674R probably damaging Het
Vmn2r114 T C 17: 23,311,212 N74D probably benign Het
Zcchc11 G A 4: 108,486,454 S221N probably benign Het
Zdbf2 T C 1: 63,304,171 Y570H possibly damaging Het
Other mutations in Tlk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00673:Tlk1 APN 2 70745516 missense probably damaging 1.00
IGL01087:Tlk1 APN 2 70752316 missense possibly damaging 0.64
IGL01514:Tlk1 APN 2 70752266 missense probably benign 0.00
IGL02976:Tlk1 APN 2 70721591 nonsense probably null
IGL03024:Tlk1 APN 2 70746036 nonsense probably null
Aku-aku UTSW 2 70738445 missense probably damaging 0.98
Heyerdahl UTSW 2 70738426 nonsense probably null
K3955:Tlk1 UTSW 2 70721701 missense possibly damaging 0.85
R0107:Tlk1 UTSW 2 70713989 makesense probably null
R0226:Tlk1 UTSW 2 70714169 unclassified probably benign
R0332:Tlk1 UTSW 2 70745565 splice site probably null
R0601:Tlk1 UTSW 2 70714158 missense probably benign 0.44
R1739:Tlk1 UTSW 2 70721077 missense probably damaging 1.00
R2080:Tlk1 UTSW 2 70738445 missense probably damaging 0.98
R2422:Tlk1 UTSW 2 70770005 missense probably damaging 1.00
R3843:Tlk1 UTSW 2 70749327 missense probably benign 0.05
R3970:Tlk1 UTSW 2 70716652 missense probably damaging 1.00
R4191:Tlk1 UTSW 2 70725547 missense probably damaging 1.00
R4867:Tlk1 UTSW 2 70721571 nonsense probably null
R5022:Tlk1 UTSW 2 70742065 missense probably benign 0.10
R5275:Tlk1 UTSW 2 70752205 intron probably benign
R5469:Tlk1 UTSW 2 70721668 missense probably benign 0.15
R6531:Tlk1 UTSW 2 70742083 missense probably benign 0.00
R6592:Tlk1 UTSW 2 70714153 missense probably damaging 1.00
R6797:Tlk1 UTSW 2 70738426 nonsense probably null
R7030:Tlk1 UTSW 2 70721928 missense probably damaging 1.00
R7705:Tlk1 UTSW 2 70786672 splice site probably null
R8284:Tlk1 UTSW 2 70714021 missense probably benign
X0028:Tlk1 UTSW 2 70746031 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGCTGACTCTAAATGCCTTGG -3'
(R):5'- AGCATAATTAGGTCTGGGATGTAGAC -3'

Sequencing Primer
(F):5'- CCTGTGGAGGCCAGAAAGTATTTC -3'
(R):5'- AGACCATCTGTGTGAGGCCATG -3'
Posted On2020-09-15