Incidental Mutation 'R7970:St6galnac2'
ID650571
Institutional Source Beutler Lab
Gene Symbol St6galnac2
Ensembl Gene ENSMUSG00000110170
Gene NameST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 2
SynonymsSiat7b, ST6GalNAc II, Siat7
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.137) question?
Stock #R7970 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location116677483-116681290 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 116690343 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 51 (D51G)
Ref Sequence ENSEMBL: ENSMUSP00000078501 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079545]
Predicted Effect probably benign
Transcript: ENSMUST00000079545
AA Change: D51G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000078501
Gene: ENSMUSG00000057286
AA Change: D51G

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Glyco_transf_29 90 373 2.9e-66 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ST6GALNAC2 belongs to a family of sialyltransferases that add sialic acids to the nonreducing ends of glycoconjugates. At the cell surface, these modifications have roles in cell-cell and cell-substrate interactions, bacterial adhesion, and protein targeting (Samyn-Petit et al., 2000 [PubMed 10742600]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knockout allele exhibit decreased body weight, decreased IgQ, increased B cell proliferation, increased pre-B cell number, abnormal erythropoiesis, increased ALT, decreased creatinine level and prominent spleen germinal center. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik A G 13: 63,033,160 N312S probably benign Het
Acnat1 A G 4: 49,449,266 F167L probably damaging Het
Acsbg2 A G 17: 56,849,728 Y437H probably benign Het
Amotl2 C T 9: 102,723,769 T345I probably benign Het
Anapc2 T C 2: 25,273,287 S179P possibly damaging Het
Arhgef1 G A 7: 24,916,881 D317N probably damaging Het
Arrdc4 G A 7: 68,741,072 P307S probably damaging Het
B3gnt2 T C 11: 22,836,255 Y311C probably damaging Het
Brf1 T C 12: 112,964,200 D453G probably damaging Het
Clpsl2 G A 17: 28,550,728 G55R probably damaging Het
Dao AGG AG 5: 114,015,209 probably benign Het
Dst G T 1: 34,182,747 C2544F possibly damaging Het
Efhc1 C T 1: 20,951,795 T21M probably benign Het
Efs A G 14: 54,920,503 probably null Het
Evl C T 12: 108,681,524 R295* probably null Het
Fam171a2 A T 11: 102,437,866 V689E possibly damaging Het
Fam184a T C 10: 53,699,325 T63A probably damaging Het
Fam186a T C 15: 99,933,586 D2897G unknown Het
Fbxw11 T G 11: 32,722,101 S224A probably benign Het
Flnc G T 6: 29,447,526 E1109D possibly damaging Het
Foxn4 A G 5: 114,263,007 probably null Het
Gm19410 A G 8: 35,815,647 E2009G probably benign Het
Gm9958 A G 5: 90,367,709 probably benign Het
Gprin3 C T 6: 59,353,165 R719Q possibly damaging Het
Grip2 A T 6: 91,786,532 I147N probably benign Het
H2-DMb2 A G 17: 34,150,598 R239G probably benign Het
Hydin A C 8: 110,309,091 D138A probably damaging Het
Ikbkap A T 4: 56,771,466 Y944N probably damaging Het
Kctd17 CAGCTGGAGGAGC CAGC 15: 78,436,913 probably benign Het
Lgr6 A G 1: 134,993,985 I484T probably benign Het
Mkrn2 T A 6: 115,617,308 C327S probably damaging Het
Mnt C T 11: 74,842,210 A288V probably damaging Het
Nckap5 T A 1: 126,025,021 K1265* probably null Het
Ncoa3 A T 2: 166,051,357 H194L probably benign Het
Ogn A T 13: 49,609,266 H28L probably benign Het
Olfr1160 A T 2: 88,005,825 F309I probably benign Het
Olfr1453 T A 19: 13,027,694 I212F probably damaging Het
Olfr680-ps1 C A 7: 105,091,349 V97L probably benign Het
Pclo T C 5: 14,714,478 S1037P Het
Phlpp1 T A 1: 106,173,285 Y428N probably damaging Het
Ptpre A G 7: 135,678,319 T591A possibly damaging Het
Rtn1 A T 12: 72,308,874 D99E probably benign Het
Scn7a A T 2: 66,675,829 I1572N probably damaging Het
Sema3a T A 5: 13,599,407 M708K possibly damaging Het
Slc12a4 G A 8: 105,951,605 R319W possibly damaging Het
Slc9a2 T C 1: 40,726,214 Y255H probably damaging Het
Spock3 T C 8: 63,345,715 F254L probably damaging Het
St6gal1 G A 16: 23,357,835 A393T probably benign Het
Stard13 T A 5: 151,063,261 K261N possibly damaging Het
Tlk1 T C 2: 70,752,300 R162G possibly damaging Het
Tlr2 T C 3: 83,837,894 D294G probably benign Het
Tnks A G 8: 34,855,926 probably null Het
Trip4 A G 9: 65,839,016 S533P probably damaging Het
Ttc3 T A 16: 94,457,364 W1674R probably damaging Het
Vmn2r114 T C 17: 23,311,212 N74D probably benign Het
Zcchc11 G A 4: 108,486,454 S221N probably benign Het
Zdbf2 T C 1: 63,304,171 Y570H possibly damaging Het
Other mutations in St6galnac2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01714:St6galnac2 APN 11 116685119 missense probably damaging 1.00
IGL01726:St6galnac2 APN 11 116685119 missense probably damaging 1.00
IGL01727:St6galnac2 APN 11 116685119 missense probably damaging 1.00
IGL01733:St6galnac2 APN 11 116685119 missense probably damaging 1.00
IGL03353:St6galnac2 APN 11 116690302 splice site probably benign
R1521:St6galnac2 UTSW 11 116684347 missense possibly damaging 0.79
R1524:St6galnac2 UTSW 11 116684487 unclassified probably benign
R1855:St6galnac2 UTSW 11 116690315 missense probably benign 0.02
R2307:St6galnac2 UTSW 11 116681905 missense probably damaging 1.00
R4079:St6galnac2 UTSW 11 116681898 missense possibly damaging 0.69
R4658:St6galnac2 UTSW 11 116684525 unclassified probably benign
R5174:St6galnac2 UTSW 11 116681947 missense probably damaging 0.99
R5436:St6galnac2 UTSW 11 116684527 unclassified probably benign
R5655:St6galnac2 UTSW 11 116685146 missense probably damaging 1.00
R6584:St6galnac2 UTSW 11 116694504 missense probably benign 0.06
R6702:St6galnac2 UTSW 11 116684387 missense probably benign 0.38
R6703:St6galnac2 UTSW 11 116684387 missense probably benign 0.38
R7090:St6galnac2 UTSW 11 116677635 missense probably damaging 1.00
R7368:St6galnac2 UTSW 11 116679979 missense probably damaging 1.00
R7607:St6galnac2 UTSW 11 116679979 missense probably damaging 1.00
R7728:St6galnac2 UTSW 11 116679985 missense probably benign 0.02
R7751:St6galnac2 UTSW 11 116677584 missense probably damaging 1.00
R7851:St6galnac2 UTSW 11 116685938 missense probably benign 0.04
R8191:St6galnac2 UTSW 11 116681922 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGGAAACACTAGTGGCCG -3'
(R):5'- ATCTAAAGAGGAAGTCATGGTCCAG -3'

Sequencing Primer
(F):5'- TTACCTCTAAGTGGGTGGAAAC -3'
(R):5'- AGTCATGGTCCAGAGAAAAGATC -3'
Posted On2020-09-15