Incidental Mutation 'R7971:Trim34a'
ID 650611
Institutional Source Beutler Lab
Gene Symbol Trim34a
Ensembl Gene ENSMUSG00000056144
Gene Name tripartite motif-containing 34A
Synonyms Trim34-1, Trim34
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock # R7971 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 104244457-104262234 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 104247818 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Arginine at position 30 (C30R)
Ref Sequence ENSEMBL: ENSMUSP00000055058 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060315] [ENSMUST00000106848] [ENSMUST00000106849]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000060315
AA Change: C30R

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000055058
Gene: ENSMUSG00000056144
AA Change: C30R

DomainStartEndE-ValueType
RING 15 58 6.79e-7 SMART
BBOX 91 132 1.08e-9 SMART
coiled coil region 194 238 N/A INTRINSIC
Blast:PRY 299 343 2e-21 BLAST
Pfam:SPRY 347 474 1e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106848
AA Change: C30R

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102461
Gene: ENSMUSG00000056144
AA Change: C30R

DomainStartEndE-ValueType
RING 15 58 6.79e-7 SMART
BBOX 91 132 1.08e-9 SMART
coiled coil region 194 238 N/A INTRINSIC
Blast:PRY 299 343 2e-21 BLAST
Pfam:SPRY 345 484 6.5e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106849
AA Change: C30R

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102462
Gene: ENSMUSG00000056144
AA Change: C30R

DomainStartEndE-ValueType
RING 15 58 6.79e-7 SMART
BBOX 91 132 1.08e-9 SMART
coiled coil region 194 238 N/A INTRINSIC
Blast:PRY 299 343 2e-21 BLAST
Pfam:SPRY 345 484 6.5e-21 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (46/47)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5530401A14Rik G A 11: 81,863,700 A16T unknown Het
Abcc1 T A 16: 14,448,579 D880E probably benign Het
Adamts2 G A 11: 50,756,696 V299I probably damaging Het
Akap6 T C 12: 53,139,795 S1331P probably damaging Het
Alms1 T C 6: 85,628,679 L1968S probably benign Het
Amotl2 C T 9: 102,723,769 T345I probably benign Het
Cacnb2 A T 2: 14,971,598 M277L possibly damaging Het
Cd80 T A 16: 38,474,029 Y91* probably null Het
Cfap46 A G 7: 139,635,127 S1561P unknown Het
Clasp1 C T 1: 118,521,829 R647W probably damaging Het
Creld1 T C 6: 113,491,972 V299A probably benign Het
Csk C A 9: 57,628,687 G260V probably benign Het
Dao AGG AG 5: 114,015,209 probably benign Het
Dgkg G A 16: 22,570,216 Q403* probably null Het
Dnaaf2 T C 12: 69,197,345 D314G probably damaging Het
Dsp T A 13: 38,192,523 L1428Q probably damaging Het
Fastkd1 A G 2: 69,707,359 V293A probably benign Het
Gm4353 C A 7: 116,083,512 S278I possibly damaging Het
Hmgb2 A G 8: 57,513,134 M75V possibly damaging Het
Hoxa4 G A 6: 52,191,731 probably benign Het
Ifi206 A T 1: 173,471,410 W877R unknown Het
Ifi44 T A 3: 151,749,220 I123F possibly damaging Het
Kcnh6 A G 11: 106,017,527 Y323C probably damaging Het
Lars T C 18: 42,218,566 T858A probably benign Het
Mest T A 6: 30,740,735 I38N Het
Npy2r A T 3: 82,540,868 I200N probably damaging Het
Olfm4 T A 14: 80,021,800 M496K probably damaging Het
Olfml2a A T 2: 38,941,782 probably null Het
Olfr894 G T 9: 38,219,547 L238F probably benign Het
Omd A T 13: 49,590,254 H260L probably benign Het
Pigk C A 3: 152,744,539 Q274K probably benign Het
Pmpca G A 2: 26,393,152 G352R probably damaging Het
Prex1 C T 2: 166,581,939 S1181N probably damaging Het
Prkg2 A T 5: 98,932,014 F762Y probably damaging Het
Rcc1l A G 5: 134,165,369 S250P probably damaging Het
Rufy1 A T 11: 50,421,671 F152Y probably damaging Het
Scaf1 T A 7: 45,003,541 T1179S unknown Het
Sh3d19 A G 3: 86,114,796 D511G probably benign Het
Shroom3 C T 5: 92,951,074 S1471L probably damaging Het
Slc12a4 G A 8: 105,951,605 R319W possibly damaging Het
Slc13a4 A G 6: 35,271,760 L484P probably damaging Het
Slc35a1 T C 4: 34,664,161 D319G probably benign Het
Synm T C 7: 67,735,235 E893G possibly damaging Het
Tatdn2 A G 6: 113,710,274 probably null Het
Thada T A 17: 84,272,769 D1419V possibly damaging Het
Tmem87b A G 2: 128,850,330 D535G probably null Het
Tnfrsf25 A C 4: 152,119,736 Q378P probably damaging Het
Triml2 T C 8: 43,190,276 S212P probably damaging Het
Tubg1 G T 11: 101,124,028 A199S probably benign Het
Other mutations in Trim34a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Trim34a APN 7 104261331 missense probably damaging 1.00
IGL00826:Trim34a APN 7 104260933 splice site probably null
IGL01526:Trim34a APN 7 104260499 missense probably damaging 1.00
IGL01859:Trim34a APN 7 104260942 missense probably damaging 0.96
IGL02052:Trim34a APN 7 104247831 missense probably benign 0.33
IGL02192:Trim34a APN 7 104247732 start codon destroyed probably null 1.00
IGL02351:Trim34a APN 7 104261234 nonsense probably null
IGL02358:Trim34a APN 7 104261234 nonsense probably null
IGL03326:Trim34a APN 7 104261380 missense probably benign 0.03
IGL03366:Trim34a APN 7 104260933 splice site probably null
Gold_belt UTSW 7 104261064 nonsense probably null
PIT4472001:Trim34a UTSW 7 104247948 missense probably damaging 1.00
PIT4791001:Trim34a UTSW 7 104260484 missense probably benign 0.15
R0115:Trim34a UTSW 7 104247902 missense probably damaging 1.00
R0848:Trim34a UTSW 7 104261124 missense probably benign
R1016:Trim34a UTSW 7 104247960 missense probably benign 0.10
R1477:Trim34a UTSW 7 104248080 missense possibly damaging 0.81
R1622:Trim34a UTSW 7 104261338 splice site probably null
R2287:Trim34a UTSW 7 104261055 missense probably damaging 1.00
R3685:Trim34a UTSW 7 104260126 splice site probably null
R4166:Trim34a UTSW 7 104261016 missense probably benign 0.02
R4967:Trim34a UTSW 7 104261064 nonsense probably null
R4979:Trim34a UTSW 7 104247862 missense probably benign 0.00
R5194:Trim34a UTSW 7 104260993 missense possibly damaging 0.70
R5443:Trim34a UTSW 7 104260213 missense possibly damaging 0.80
R5631:Trim34a UTSW 7 104248739 missense probably damaging 1.00
R5902:Trim34a UTSW 7 104261121 nonsense probably null
R6147:Trim34a UTSW 7 104261191 missense probably damaging 0.99
R6644:Trim34a UTSW 7 104261037 missense probably damaging 1.00
R8060:Trim34a UTSW 7 104260976 missense probably damaging 1.00
R8278:Trim34a UTSW 7 104249416 missense probably damaging 0.99
R8356:Trim34a UTSW 7 104260971 missense probably damaging 0.99
R9275:Trim34a UTSW 7 104260994 missense probably damaging 0.96
R9563:Trim34a UTSW 7 104261121 nonsense probably null
X0023:Trim34a UTSW 7 104259415 missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- GAATCTGCCTAGCCATCCAG -3'
(R):5'- CCTCCTTACAGAAGAGAAGGAGC -3'

Sequencing Primer
(F):5'- TAGCCATCCAGCAGTCCTTAAG -3'
(R):5'- TCTCCATGGTGTACACAGAGATC -3'
Posted On 2020-09-15