Incidental Mutation 'R7971:Amotl2'
ID 650619
Institutional Source Beutler Lab
Gene Symbol Amotl2
Ensembl Gene ENSMUSG00000032531
Gene Name angiomotin-like 2
Synonyms Lccp, MASCOT
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.213) question?
Stock # R7971 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 102716672-102733418 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 102723769 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 345 (T345I)
Ref Sequence ENSEMBL: ENSMUSP00000121113 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035121] [ENSMUST00000134483] [ENSMUST00000142011] [ENSMUST00000145913] [ENSMUST00000145937] [ENSMUST00000153911] [ENSMUST00000153965] [ENSMUST00000156485] [ENSMUST00000190047]
AlphaFold Q8K371
Predicted Effect probably benign
Transcript: ENSMUST00000035121
AA Change: T312I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000035121
Gene: ENSMUSG00000032531
AA Change: T312I

DomainStartEndE-ValueType
low complexity region 33 53 N/A INTRINSIC
low complexity region 72 83 N/A INTRINSIC
low complexity region 157 170 N/A INTRINSIC
low complexity region 192 215 N/A INTRINSIC
low complexity region 248 268 N/A INTRINSIC
Blast:PAC 352 393 1e-12 BLAST
low complexity region 422 436 N/A INTRINSIC
Pfam:Angiomotin_C 478 688 2.3e-98 PFAM
low complexity region 698 710 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000115845
Gene: ENSMUSG00000032531
AA Change: T126I

DomainStartEndE-ValueType
low complexity region 30 50 N/A INTRINSIC
Blast:PAC 134 175 8e-13 BLAST
low complexity region 204 218 N/A INTRINSIC
Pfam:Angiomotin_C 260 470 4.9e-98 PFAM
low complexity region 480 492 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134483
Predicted Effect probably benign
Transcript: ENSMUST00000142011
AA Change: T312I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000120378
Gene: ENSMUSG00000032531
AA Change: T312I

DomainStartEndE-ValueType
low complexity region 33 53 N/A INTRINSIC
low complexity region 72 83 N/A INTRINSIC
low complexity region 157 170 N/A INTRINSIC
low complexity region 192 215 N/A INTRINSIC
low complexity region 248 268 N/A INTRINSIC
Blast:PAC 352 393 1e-12 BLAST
low complexity region 422 436 N/A INTRINSIC
Pfam:Angiomotin_C 478 686 1.2e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145913
SMART Domains Protein: ENSMUSP00000118126
Gene: ENSMUSG00000032531

DomainStartEndE-ValueType
low complexity region 33 53 N/A INTRINSIC
low complexity region 72 83 N/A INTRINSIC
low complexity region 157 170 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145937
SMART Domains Protein: ENSMUSP00000114950
Gene: ENSMUSG00000032531

DomainStartEndE-ValueType
low complexity region 33 53 N/A INTRINSIC
low complexity region 72 83 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153911
SMART Domains Protein: ENSMUSP00000119903
Gene: ENSMUSG00000032531

DomainStartEndE-ValueType
low complexity region 56 76 N/A INTRINSIC
low complexity region 95 106 N/A INTRINSIC
low complexity region 180 193 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153965
AA Change: T345I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000121113
Gene: ENSMUSG00000032531
AA Change: T345I

DomainStartEndE-ValueType
low complexity region 66 86 N/A INTRINSIC
low complexity region 105 116 N/A INTRINSIC
low complexity region 190 203 N/A INTRINSIC
low complexity region 225 248 N/A INTRINSIC
low complexity region 281 301 N/A INTRINSIC
Blast:PAC 385 426 1e-12 BLAST
low complexity region 455 469 N/A INTRINSIC
Pfam:Angiomotin_C 511 719 3.7e-94 PFAM
low complexity region 731 743 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156485
SMART Domains Protein: ENSMUSP00000116554
Gene: ENSMUSG00000032531

DomainStartEndE-ValueType
low complexity region 33 53 N/A INTRINSIC
low complexity region 72 83 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190047
SMART Domains Protein: ENSMUSP00000140688
Gene: ENSMUSG00000032531

DomainStartEndE-ValueType
coiled coil region 1 114 N/A INTRINSIC
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Angiomotin is a protein that binds angiostatin, a circulating inhibitor of the formation of new blood vessels (angiogenesis). Angiomotin mediates angiostatin inhibition of endothelial cell migration and tube formation in vitro. The protein encoded by this gene is related to angiomotin and is a member of the motin protein family. Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, Jul 2013]
PHENOTYPE: Conditional homozygous knockout in endothelial cells during embryonic development leads to aortic restriction in the embryo. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5530401A14Rik G A 11: 81,863,700 A16T unknown Het
Abcc1 T A 16: 14,448,579 D880E probably benign Het
Adamts2 G A 11: 50,756,696 V299I probably damaging Het
Akap6 T C 12: 53,139,795 S1331P probably damaging Het
Alms1 T C 6: 85,628,679 L1968S probably benign Het
Cacnb2 A T 2: 14,971,598 M277L possibly damaging Het
Cd80 T A 16: 38,474,029 Y91* probably null Het
Cfap46 A G 7: 139,635,127 S1561P unknown Het
Clasp1 C T 1: 118,521,829 R647W probably damaging Het
Creld1 T C 6: 113,491,972 V299A probably benign Het
Csk C A 9: 57,628,687 G260V probably benign Het
Dao AGG AG 5: 114,015,209 probably benign Het
Dgkg G A 16: 22,570,216 Q403* probably null Het
Dnaaf2 T C 12: 69,197,345 D314G probably damaging Het
Dsp T A 13: 38,192,523 L1428Q probably damaging Het
Fastkd1 A G 2: 69,707,359 V293A probably benign Het
Gm4353 C A 7: 116,083,512 S278I possibly damaging Het
Hmgb2 A G 8: 57,513,134 M75V possibly damaging Het
Hoxa4 G A 6: 52,191,731 probably benign Het
Ifi206 A T 1: 173,471,410 W877R unknown Het
Ifi44 T A 3: 151,749,220 I123F possibly damaging Het
Kcnh6 A G 11: 106,017,527 Y323C probably damaging Het
Lars T C 18: 42,218,566 T858A probably benign Het
Mest T A 6: 30,740,735 I38N Het
Npy2r A T 3: 82,540,868 I200N probably damaging Het
Olfm4 T A 14: 80,021,800 M496K probably damaging Het
Olfml2a A T 2: 38,941,782 probably null Het
Olfr894 G T 9: 38,219,547 L238F probably benign Het
Omd A T 13: 49,590,254 H260L probably benign Het
Pigk C A 3: 152,744,539 Q274K probably benign Het
Pmpca G A 2: 26,393,152 G352R probably damaging Het
Prex1 C T 2: 166,581,939 S1181N probably damaging Het
Prkg2 A T 5: 98,932,014 F762Y probably damaging Het
Rcc1l A G 5: 134,165,369 S250P probably damaging Het
Rufy1 A T 11: 50,421,671 F152Y probably damaging Het
Scaf1 T A 7: 45,003,541 T1179S unknown Het
Sh3d19 A G 3: 86,114,796 D511G probably benign Het
Shroom3 C T 5: 92,951,074 S1471L probably damaging Het
Slc12a4 G A 8: 105,951,605 R319W possibly damaging Het
Slc13a4 A G 6: 35,271,760 L484P probably damaging Het
Slc35a1 T C 4: 34,664,161 D319G probably benign Het
Synm T C 7: 67,735,235 E893G possibly damaging Het
Tatdn2 A G 6: 113,710,274 probably null Het
Thada T A 17: 84,272,769 D1419V possibly damaging Het
Tmem87b A G 2: 128,850,330 D535G probably null Het
Tnfrsf25 A C 4: 152,119,736 Q378P probably damaging Het
Trim34a T C 7: 104,247,818 C30R probably damaging Het
Triml2 T C 8: 43,190,276 S212P probably damaging Het
Tubg1 G T 11: 101,124,028 A199S probably benign Het
Other mutations in Amotl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02002:Amotl2 APN 9 102725117 missense probably damaging 1.00
IGL02207:Amotl2 APN 9 102724697 missense probably damaging 1.00
R0471:Amotl2 UTSW 9 102720519 missense probably damaging 0.98
R1420:Amotl2 UTSW 9 102724783 missense possibly damaging 0.91
R1483:Amotl2 UTSW 9 102730897 missense probably benign 0.16
R1525:Amotl2 UTSW 9 102728568 missense probably damaging 1.00
R1661:Amotl2 UTSW 9 102730096 missense probably damaging 0.99
R1945:Amotl2 UTSW 9 102720554 missense probably benign
R2113:Amotl2 UTSW 9 102724723 nonsense probably null
R2157:Amotl2 UTSW 9 102730589 unclassified probably benign
R4084:Amotl2 UTSW 9 102724685 critical splice acceptor site probably null
R4726:Amotl2 UTSW 9 102723819 missense probably benign 0.00
R4755:Amotl2 UTSW 9 102720480 missense probably damaging 1.00
R4782:Amotl2 UTSW 9 102720123 critical splice donor site probably null
R4819:Amotl2 UTSW 9 102730071 missense probably damaging 1.00
R5048:Amotl2 UTSW 9 102723798 missense probably benign 0.00
R5328:Amotl2 UTSW 9 102723768 missense probably benign
R5894:Amotl2 UTSW 9 102725172 missense possibly damaging 0.79
R6956:Amotl2 UTSW 9 102724768 missense probably damaging 1.00
R7304:Amotl2 UTSW 9 102728350 missense probably damaging 1.00
R7390:Amotl2 UTSW 9 102731690 missense probably damaging 1.00
R7474:Amotl2 UTSW 9 102730111 missense probably benign 0.00
R7816:Amotl2 UTSW 9 102731654 missense probably benign 0.43
R7967:Amotl2 UTSW 9 102723769 missense probably benign 0.00
R7969:Amotl2 UTSW 9 102723769 missense probably benign 0.00
R7970:Amotl2 UTSW 9 102723769 missense probably benign 0.00
R7972:Amotl2 UTSW 9 102723769 missense probably benign 0.00
R7973:Amotl2 UTSW 9 102723769 missense probably benign 0.00
R8017:Amotl2 UTSW 9 102723769 missense probably benign 0.00
R8019:Amotl2 UTSW 9 102723769 missense probably benign 0.00
R8045:Amotl2 UTSW 9 102723769 missense probably benign 0.00
R8046:Amotl2 UTSW 9 102723769 missense probably benign 0.00
R8131:Amotl2 UTSW 9 102720416 missense probably damaging 1.00
R8754:Amotl2 UTSW 9 102720159 missense possibly damaging 0.53
R8813:Amotl2 UTSW 9 102730092 missense probably damaging 1.00
R9071:Amotl2 UTSW 9 102718693 start gained probably benign
R9399:Amotl2 UTSW 9 102729332 missense probably damaging 0.99
X0022:Amotl2 UTSW 9 102729470 missense probably damaging 1.00
Z1088:Amotl2 UTSW 9 102723698 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GGGGCTCTGAGCTTTATTCACC -3'
(R):5'- TATGGTGCAAAAGGTAGCCTG -3'

Sequencing Primer
(F):5'- TTTCCCAGGATCCTGCAGG -3'
(R):5'- TATGGTGCAAAAGGTAGCCTGATAGG -3'
Posted On 2020-09-15