Incidental Mutation 'R7971:Abcc1'
ID650630
Institutional Source Beutler Lab
Gene Symbol Abcc1
Ensembl Gene ENSMUSG00000023088
Gene NameATP-binding cassette, sub-family C (CFTR/MRP), member 1
SynonymsMrp1, Mdrap, MRP, Abcc1b, Abcc1a
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R7971 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location14361558-14475737 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 14448579 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 880 (D880E)
Ref Sequence ENSEMBL: ENSMUSP00000097743 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100167] [ENSMUST00000130671] [ENSMUST00000133454] [ENSMUST00000147759]
Predicted Effect probably benign
Transcript: ENSMUST00000100167
AA Change: D880E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000097743
Gene: ENSMUSG00000023088
AA Change: D880E

DomainStartEndE-ValueType
transmembrane domain 38 57 N/A INTRINSIC
transmembrane domain 77 94 N/A INTRINSIC
transmembrane domain 104 126 N/A INTRINSIC
transmembrane domain 139 161 N/A INTRINSIC
transmembrane domain 176 198 N/A INTRINSIC
low complexity region 279 290 N/A INTRINSIC
Pfam:ABC_membrane 326 597 7.8e-44 PFAM
AAA 670 845 4.07e-8 SMART
Pfam:ABC_membrane 971 1243 3e-52 PFAM
AAA 1316 1501 5.8e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130671
SMART Domains Protein: ENSMUSP00000116714
Gene: ENSMUSG00000023088

DomainStartEndE-ValueType
transmembrane domain 38 57 N/A INTRINSIC
transmembrane domain 77 94 N/A INTRINSIC
transmembrane domain 104 126 N/A INTRINSIC
transmembrane domain 139 161 N/A INTRINSIC
transmembrane domain 176 198 N/A INTRINSIC
low complexity region 279 290 N/A INTRINSIC
Pfam:ABC_membrane 326 597 1.6e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133454
SMART Domains Protein: ENSMUSP00000122656
Gene: ENSMUSG00000023088

DomainStartEndE-ValueType
transmembrane domain 38 57 N/A INTRINSIC
transmembrane domain 77 94 N/A INTRINSIC
transmembrane domain 104 126 N/A INTRINSIC
transmembrane domain 139 161 N/A INTRINSIC
transmembrane domain 176 198 N/A INTRINSIC
low complexity region 279 290 N/A INTRINSIC
Pfam:ABC_membrane 326 597 1.6e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147759
SMART Domains Protein: ENSMUSP00000115627
Gene: ENSMUSG00000023088

DomainStartEndE-ValueType
transmembrane domain 38 57 N/A INTRINSIC
transmembrane domain 77 94 N/A INTRINSIC
transmembrane domain 104 126 N/A INTRINSIC
transmembrane domain 139 161 N/A INTRINSIC
transmembrane domain 176 198 N/A INTRINSIC
low complexity region 279 290 N/A INTRINSIC
Pfam:ABC_membrane 326 597 1.6e-48 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This full transporter is a member of the MRP subfamily which is involved in multi-drug resistance. This protein plays an essential role in the defense against toxic compounds and serves as the major high-affinity transporter of leukotriene C4. The encoded protein may also play an essential role in steroid hormone homeostasis as a transporter for steroid hormones and their metabolites. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene have a reduced response to inflammatory stimulus, increased levels of glutathione due to impaired metabolism, and are hypersensitive to the anticancer drug etoposide. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5530401A14Rik G A 11: 81,863,700 A16T unknown Het
Adamts2 G A 11: 50,756,696 V299I probably damaging Het
Akap6 T C 12: 53,139,795 S1331P probably damaging Het
Alms1 T C 6: 85,628,679 L1968S probably benign Het
Amotl2 C T 9: 102,723,769 T345I probably benign Het
Cacnb2 A T 2: 14,971,598 M277L possibly damaging Het
Cd80 T A 16: 38,474,029 Y91* probably null Het
Cfap46 A G 7: 139,635,127 S1561P unknown Het
Clasp1 C T 1: 118,521,829 R647W probably damaging Het
Creld1 T C 6: 113,491,972 V299A probably benign Het
Csk C A 9: 57,628,687 G260V probably benign Het
Dao AGG AG 5: 114,015,209 probably benign Het
Dgkg G A 16: 22,570,216 Q403* probably null Het
Dnaaf2 T C 12: 69,197,345 D314G probably damaging Het
Dsp T A 13: 38,192,523 L1428Q probably damaging Het
Fastkd1 A G 2: 69,707,359 V293A probably benign Het
Gm4353 C A 7: 116,083,512 S278I possibly damaging Het
Hmgb2 A G 8: 57,513,134 M75V possibly damaging Het
Hoxa4 G A 6: 52,191,731 probably benign Het
Ifi206 A T 1: 173,471,410 W877R unknown Het
Ifi44 T A 3: 151,749,220 I123F possibly damaging Het
Kcnh6 A G 11: 106,017,527 Y323C probably damaging Het
Lars T C 18: 42,218,566 T858A probably benign Het
Mest T A 6: 30,740,735 I38N Het
Npy2r A T 3: 82,540,868 I200N probably damaging Het
Olfm4 T A 14: 80,021,800 M496K probably damaging Het
Olfr894 G T 9: 38,219,547 L238F probably benign Het
Omd A T 13: 49,590,254 H260L probably benign Het
Pigk C A 3: 152,744,539 Q274K probably benign Het
Pmpca G A 2: 26,393,152 G352R probably damaging Het
Prex1 C T 2: 166,581,939 S1181N probably damaging Het
Prkg2 A T 5: 98,932,014 F762Y probably damaging Het
Rcc1l A G 5: 134,165,369 S250P probably damaging Het
Rufy1 A T 11: 50,421,671 F152Y probably damaging Het
Scaf1 T A 7: 45,003,541 T1179S unknown Het
Sh3d19 A G 3: 86,114,796 D511G probably benign Het
Shroom3 C T 5: 92,951,074 S1471L probably damaging Het
Slc12a4 G A 8: 105,951,605 R319W possibly damaging Het
Slc13a4 A G 6: 35,271,760 L484P probably damaging Het
Slc35a1 T C 4: 34,664,161 D319G probably benign Het
Synm T C 7: 67,735,235 E893G possibly damaging Het
Thada T A 17: 84,272,769 D1419V possibly damaging Het
Tmem87b A G 2: 128,850,330 D535G probably null Het
Tnfrsf25 A C 4: 152,119,736 Q378P probably damaging Het
Trim34a T C 7: 104,247,818 C30R probably damaging Het
Triml2 T C 8: 43,190,276 S212P probably damaging Het
Tubg1 G T 11: 101,124,028 A199S probably benign Het
Other mutations in Abcc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Abcc1 APN 16 14460983 missense probably benign 0.34
IGL00094:Abcc1 APN 16 14470534 missense probably null 0.00
IGL00475:Abcc1 APN 16 14436573 missense probably damaging 1.00
IGL00516:Abcc1 APN 16 14413312 nonsense probably null
IGL00765:Abcc1 APN 16 14411508 missense probably damaging 0.99
IGL00792:Abcc1 APN 16 14410926 missense probably benign 0.18
IGL01678:Abcc1 APN 16 14405019 missense probably null 0.96
IGL01683:Abcc1 APN 16 14396424 missense probably damaging 1.00
IGL01955:Abcc1 APN 16 14410795 missense probably damaging 1.00
IGL02048:Abcc1 APN 16 14411519 missense probably damaging 0.98
IGL02345:Abcc1 APN 16 14396351 missense possibly damaging 0.95
IGL02366:Abcc1 APN 16 14467979 splice site probably benign
IGL02431:Abcc1 APN 16 14419734 missense probably damaging 1.00
IGL02480:Abcc1 APN 16 14404005 missense possibly damaging 0.87
IGL02651:Abcc1 APN 16 14466126 missense probably benign 0.00
IGL02902:Abcc1 APN 16 14423127 missense probably damaging 1.00
IGL03101:Abcc1 APN 16 14389868 missense probably damaging 1.00
IGL03230:Abcc1 APN 16 14457947 missense probably benign
IGL03308:Abcc1 APN 16 14470611 missense possibly damaging 0.55
PIT4544001:Abcc1 UTSW 16 14405079 missense probably damaging 1.00
R0310:Abcc1 UTSW 16 14410927 missense probably damaging 0.98
R0594:Abcc1 UTSW 16 14389880 missense probably benign 0.05
R0894:Abcc1 UTSW 16 14465137 missense possibly damaging 0.64
R0928:Abcc1 UTSW 16 14389985 critical splice donor site probably null
R1367:Abcc1 UTSW 16 14443386 missense probably damaging 1.00
R1496:Abcc1 UTSW 16 14448434 missense probably damaging 1.00
R1643:Abcc1 UTSW 16 14413368 missense probably damaging 1.00
R1795:Abcc1 UTSW 16 14465137 missense possibly damaging 0.64
R1834:Abcc1 UTSW 16 14423117 missense possibly damaging 0.88
R1847:Abcc1 UTSW 16 14445449 missense probably benign 0.02
R1959:Abcc1 UTSW 16 14396393 missense probably damaging 1.00
R1961:Abcc1 UTSW 16 14396393 missense probably damaging 1.00
R2017:Abcc1 UTSW 16 14461204 missense probably damaging 1.00
R2224:Abcc1 UTSW 16 14472068 missense probably damaging 1.00
R2377:Abcc1 UTSW 16 14467923 missense probably damaging 0.97
R2513:Abcc1 UTSW 16 14473009 splice site probably null
R2876:Abcc1 UTSW 16 14457960 missense probably benign
R3003:Abcc1 UTSW 16 14436529 missense probably damaging 1.00
R3941:Abcc1 UTSW 16 14396399 missense probably benign 0.00
R4119:Abcc1 UTSW 16 14394013 missense probably benign 0.43
R4191:Abcc1 UTSW 16 14389864 missense probably damaging 1.00
R4369:Abcc1 UTSW 16 14460993 missense possibly damaging 0.88
R4428:Abcc1 UTSW 16 14445300 missense probably damaging 0.97
R4589:Abcc1 UTSW 16 14394031 missense probably benign 0.00
R4779:Abcc1 UTSW 16 14410771 missense probably benign 0.35
R5027:Abcc1 UTSW 16 14404053 critical splice donor site probably null
R5275:Abcc1 UTSW 16 14466186 missense probably damaging 1.00
R5418:Abcc1 UTSW 16 14461132 missense probably benign 0.02
R5490:Abcc1 UTSW 16 14410917 missense probably damaging 1.00
R5527:Abcc1 UTSW 16 14460978 missense probably benign 0.18
R5641:Abcc1 UTSW 16 14472013 missense probably benign 0.00
R5642:Abcc1 UTSW 16 14443455 missense probably damaging 1.00
R5875:Abcc1 UTSW 16 14467037 missense possibly damaging 0.94
R5916:Abcc1 UTSW 16 14465142 missense possibly damaging 0.95
R6112:Abcc1 UTSW 16 14460916 missense probably damaging 1.00
R6331:Abcc1 UTSW 16 14465056 missense probably damaging 0.97
R6464:Abcc1 UTSW 16 14447490 missense probably damaging 1.00
R6950:Abcc1 UTSW 16 14411616 missense probably damaging 1.00
R7024:Abcc1 UTSW 16 14413383 critical splice donor site probably null
R7115:Abcc1 UTSW 16 14437725 missense probably benign 0.11
R7187:Abcc1 UTSW 16 14466997 missense probably benign
R7298:Abcc1 UTSW 16 14396472 missense possibly damaging 0.89
R7342:Abcc1 UTSW 16 14465169 missense probably damaging 0.99
R7474:Abcc1 UTSW 16 14472986 missense possibly damaging 0.95
R7488:Abcc1 UTSW 16 14389899 nonsense probably null
R7583:Abcc1 UTSW 16 14404038 missense probably damaging 1.00
R7619:Abcc1 UTSW 16 14445419 missense probably damaging 0.96
R8048:Abcc1 UTSW 16 14410844 missense probably damaging 1.00
R8138:Abcc1 UTSW 16 14472887 missense probably damaging 0.99
R8159:Abcc1 UTSW 16 14472930 missense probably damaging 0.96
R8319:Abcc1 UTSW 16 14396451 missense probably damaging 1.00
X0026:Abcc1 UTSW 16 14459902 missense possibly damaging 0.94
Z1088:Abcc1 UTSW 16 14410809 missense probably benign 0.01
Z1177:Abcc1 UTSW 16 14411493 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCCTCCATGGTGCTGATG -3'
(R):5'- AGAACCCTCTCTACCTGACCTG -3'

Sequencing Primer
(F):5'- TTTACCCATAGACACGGATCCTGG -3'
(R):5'- CCTGCAAGGTTAAACTGACCTATTGG -3'
Posted On2020-09-15