Incidental Mutation 'R7972:Styxl2'
ID 650636
Institutional Source Beutler Lab
Gene Symbol Styxl2
Ensembl Gene ENSMUSG00000026564
Gene Name serine/threonine/tyrosine interacting like 2
Synonyms C130085G02Rik, Dusp27
MMRRC Submission 046015-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7972 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 165925717-165955467 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 165926708 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Valine at position 968 (E968V)
Ref Sequence ENSEMBL: ENSMUSP00000083155 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085992] [ENSMUST00000192369]
AlphaFold Q148W8
Predicted Effect probably damaging
Transcript: ENSMUST00000085992
AA Change: E968V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000083155
Gene: ENSMUSG00000026564
AA Change: E968V

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
DSPc 133 277 2.45e-30 SMART
low complexity region 339 348 N/A INTRINSIC
low complexity region 404 425 N/A INTRINSIC
low complexity region 429 439 N/A INTRINSIC
low complexity region 618 635 N/A INTRINSIC
low complexity region 655 666 N/A INTRINSIC
low complexity region 773 788 N/A INTRINSIC
coiled coil region 813 839 N/A INTRINSIC
low complexity region 851 860 N/A INTRINSIC
low complexity region 936 950 N/A INTRINSIC
low complexity region 1001 1019 N/A INTRINSIC
low complexity region 1026 1040 N/A INTRINSIC
low complexity region 1074 1091 N/A INTRINSIC
low complexity region 1108 1120 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000192369
AA Change: E968V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141564
Gene: ENSMUSG00000026564
AA Change: E968V

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
DSPc 133 277 2.45e-30 SMART
low complexity region 339 348 N/A INTRINSIC
low complexity region 404 425 N/A INTRINSIC
low complexity region 429 439 N/A INTRINSIC
low complexity region 618 635 N/A INTRINSIC
low complexity region 655 666 N/A INTRINSIC
low complexity region 773 788 N/A INTRINSIC
coiled coil region 813 839 N/A INTRINSIC
low complexity region 851 860 N/A INTRINSIC
low complexity region 936 950 N/A INTRINSIC
low complexity region 1001 1019 N/A INTRINSIC
low complexity region 1026 1040 N/A INTRINSIC
low complexity region 1074 1091 N/A INTRINSIC
low complexity region 1108 1120 N/A INTRINSIC
Meta Mutation Damage Score 0.2076 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (48/49)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd16a T A 17: 35,320,287 (GRCm39) V384E probably damaging Het
Acacb C T 5: 114,364,918 (GRCm39) R1533* probably null Het
Alox12 T A 11: 70,133,513 (GRCm39) M604L probably benign Het
Amotl2 C T 9: 102,600,968 (GRCm39) T345I probably benign Het
Brdt A T 5: 107,496,415 (GRCm39) I176F possibly damaging Het
Cdk5 G T 5: 24,624,656 (GRCm39) T245K probably benign Het
Chd9 A T 8: 91,732,395 (GRCm39) R1304S unknown Het
Clpsl2 G A 17: 28,769,702 (GRCm39) G55R probably damaging Het
Cyp2j11 T A 4: 96,185,871 (GRCm39) E438V probably damaging Het
Dao AGG AG 5: 114,153,270 (GRCm39) probably benign Het
Dnah10 T C 5: 124,803,949 (GRCm39) V92A probably benign Het
Evl C T 12: 108,647,783 (GRCm39) R295* probably null Het
Fam184a A T 10: 53,514,355 (GRCm39) L1022Q probably damaging Het
Foxd4 T C 19: 24,877,594 (GRCm39) H202R probably damaging Het
Fry T C 5: 150,233,861 (GRCm39) V16A probably benign Het
Gstcd A T 3: 132,777,894 (GRCm39) F306I probably benign Het
H2bc13 A G 13: 21,899,977 (GRCm39) S113P possibly damaging Het
Hivep3 T C 4: 119,954,711 (GRCm39) V1009A possibly damaging Het
Hoxd12 G T 2: 74,506,269 (GRCm39) R227L probably damaging Het
Ifi208 T A 1: 173,506,556 (GRCm39) M113K possibly damaging Het
Ift70a1 A T 2: 75,810,802 (GRCm39) M427K probably damaging Het
Kcnh4 T G 11: 100,643,278 (GRCm39) T330P probably damaging Het
Kctd17 CAGCTGGAGGAGC CAGC 15: 78,321,113 (GRCm39) probably benign Het
Lin28a G A 4: 133,733,574 (GRCm39) P158S probably damaging Het
Muc16 C A 9: 18,557,060 (GRCm39) E3078* probably null Het
Naaladl1 A G 19: 6,156,274 (GRCm39) N120S probably damaging Het
Nol10 G A 12: 17,402,648 (GRCm39) R40H probably benign Het
Ntng1 G A 3: 110,042,802 (GRCm39) S8L probably benign Het
Or4a71 T G 2: 89,357,948 (GRCm39) I269L probably benign Het
Or4c107 T A 2: 88,789,177 (GRCm39) Y122* probably null Het
Pacsin1 T A 17: 27,927,613 (GRCm39) F319I unknown Het
Pla2g4d G A 2: 120,109,413 (GRCm39) T212I probably benign Het
Ppp4r1 T A 17: 66,140,093 (GRCm39) C664S possibly damaging Het
Prodh2 T C 7: 30,210,580 (GRCm39) I377T probably damaging Het
Prss57 A T 10: 79,619,230 (GRCm39) L243H probably benign Het
Pxdn C T 12: 30,056,601 (GRCm39) L1271F probably damaging Het
Ros1 G A 10: 52,030,926 (GRCm39) R581* probably null Het
Rps6kc1 C T 1: 190,531,321 (GRCm39) G894S probably benign Het
Sirt7 A G 11: 120,510,016 (GRCm39) S183P unknown Het
Slc12a4 G A 8: 106,678,237 (GRCm39) R319W possibly damaging Het
Son AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,457,222 (GRCm39) probably benign Het
Tbc1d8 A G 1: 39,431,250 (GRCm39) F374S probably damaging Het
Tdrd1 T A 19: 56,837,134 (GRCm39) D489E probably damaging Het
Tiprl T A 1: 165,064,543 (GRCm39) probably benign Het
Tpt1 T C 14: 76,085,539 (GRCm39) *173Q probably null Het
Trim17 A G 11: 58,859,394 (GRCm39) I203V probably benign Het
Trim43b T A 9: 88,973,361 (GRCm39) H124L probably damaging Het
Triobp T C 15: 78,852,186 (GRCm39) I780T probably damaging Het
Tyrobp G A 7: 30,114,063 (GRCm39) G101R Het
Vmn1r181 A T 7: 23,683,871 (GRCm39) H112L probably benign Het
Wdr19 A G 5: 65,381,193 (GRCm39) N406D probably damaging Het
Zc3h12a T C 4: 125,013,728 (GRCm39) K379E probably benign Het
Zcwpw1 T C 5: 137,799,323 (GRCm39) I230T probably benign Het
Zfhx4 A G 3: 5,477,533 (GRCm39) T3383A probably benign Het
Other mutations in Styxl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00706:Styxl2 APN 1 165,928,121 (GRCm39) missense probably benign 0.00
IGL00973:Styxl2 APN 1 165,927,027 (GRCm39) missense probably benign
IGL01331:Styxl2 APN 1 165,935,749 (GRCm39) missense probably damaging 1.00
IGL01466:Styxl2 APN 1 165,928,073 (GRCm39) missense probably damaging 1.00
IGL01572:Styxl2 APN 1 165,927,941 (GRCm39) missense probably benign 0.18
IGL01906:Styxl2 APN 1 165,927,092 (GRCm39) missense probably damaging 1.00
IGL01974:Styxl2 APN 1 165,928,105 (GRCm39) nonsense probably null
IGL02112:Styxl2 APN 1 165,927,240 (GRCm39) nonsense probably null
IGL02805:Styxl2 APN 1 165,926,630 (GRCm39) missense probably damaging 1.00
IGL03343:Styxl2 APN 1 165,927,017 (GRCm39) missense probably benign 0.00
R0116:Styxl2 UTSW 1 165,927,270 (GRCm39) missense probably benign 0.19
R0367:Styxl2 UTSW 1 165,928,332 (GRCm39) missense probably benign 0.05
R0499:Styxl2 UTSW 1 165,926,670 (GRCm39) missense probably benign 0.00
R0542:Styxl2 UTSW 1 165,928,853 (GRCm39) missense possibly damaging 0.90
R1312:Styxl2 UTSW 1 165,926,860 (GRCm39) missense possibly damaging 0.46
R1572:Styxl2 UTSW 1 165,927,024 (GRCm39) missense possibly damaging 0.68
R1598:Styxl2 UTSW 1 165,937,828 (GRCm39) missense probably benign 0.10
R1858:Styxl2 UTSW 1 165,928,415 (GRCm39) missense possibly damaging 0.87
R2021:Styxl2 UTSW 1 165,928,392 (GRCm39) missense probably benign 0.00
R2970:Styxl2 UTSW 1 165,926,798 (GRCm39) missense probably benign 0.04
R3727:Styxl2 UTSW 1 165,927,075 (GRCm39) missense probably damaging 1.00
R4041:Styxl2 UTSW 1 165,927,680 (GRCm39) missense probably benign 0.01
R4245:Styxl2 UTSW 1 165,928,685 (GRCm39) missense probably damaging 1.00
R4955:Styxl2 UTSW 1 165,935,661 (GRCm39) missense probably damaging 1.00
R4967:Styxl2 UTSW 1 165,954,675 (GRCm39) missense probably damaging 1.00
R5040:Styxl2 UTSW 1 165,927,914 (GRCm39) missense probably benign 0.17
R5342:Styxl2 UTSW 1 165,937,819 (GRCm39) missense probably benign 0.01
R5467:Styxl2 UTSW 1 165,939,599 (GRCm39) critical splice donor site probably null
R5742:Styxl2 UTSW 1 165,927,023 (GRCm39) missense probably benign 0.00
R6222:Styxl2 UTSW 1 165,926,214 (GRCm39) missense probably benign 0.26
R6239:Styxl2 UTSW 1 165,926,388 (GRCm39) missense probably damaging 1.00
R6531:Styxl2 UTSW 1 165,937,615 (GRCm39) splice site probably null
R6586:Styxl2 UTSW 1 165,928,454 (GRCm39) missense possibly damaging 0.79
R6958:Styxl2 UTSW 1 165,935,565 (GRCm39) missense probably damaging 1.00
R7006:Styxl2 UTSW 1 165,926,663 (GRCm39) missense probably benign
R7111:Styxl2 UTSW 1 165,954,723 (GRCm39) missense possibly damaging 0.66
R7310:Styxl2 UTSW 1 165,926,300 (GRCm39) missense possibly damaging 0.46
R7312:Styxl2 UTSW 1 165,954,676 (GRCm39) missense probably damaging 0.99
R7378:Styxl2 UTSW 1 165,939,632 (GRCm39) nonsense probably null
R7398:Styxl2 UTSW 1 165,928,044 (GRCm39) missense probably damaging 1.00
R7442:Styxl2 UTSW 1 165,928,584 (GRCm39) missense probably benign 0.01
R7569:Styxl2 UTSW 1 165,935,604 (GRCm39) missense probably damaging 1.00
R7920:Styxl2 UTSW 1 165,927,465 (GRCm39) missense possibly damaging 0.72
R7954:Styxl2 UTSW 1 165,926,849 (GRCm39) missense probably benign 0.05
R8186:Styxl2 UTSW 1 165,927,648 (GRCm39) missense probably damaging 1.00
R8354:Styxl2 UTSW 1 165,935,702 (GRCm39) missense probably damaging 1.00
R8454:Styxl2 UTSW 1 165,935,702 (GRCm39) missense probably damaging 1.00
R8535:Styxl2 UTSW 1 165,928,730 (GRCm39) missense probably benign 0.01
R9419:Styxl2 UTSW 1 165,927,755 (GRCm39) missense probably damaging 1.00
R9493:Styxl2 UTSW 1 165,926,410 (GRCm39) missense probably damaging 1.00
R9694:Styxl2 UTSW 1 165,928,654 (GRCm39) missense probably damaging 1.00
Z1088:Styxl2 UTSW 1 165,926,852 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCAAACTCAGCGAAGTCTG -3'
(R):5'- TATAGAAATGGCCGCAGCATG -3'

Sequencing Primer
(F):5'- CCAAACTCAGCGAAGTCTGATTTAG -3'
(R):5'- CCGCAGCATGGGTAACGAG -3'
Posted On 2020-09-15