Incidental Mutation 'R7972:Hoxd12'
ID650639
Institutional Source Beutler Lab
Gene Symbol Hoxd12
Ensembl Gene ENSMUSG00000001823
Gene Namehomeobox D12
SynonymsHox-4.7, Hox-5.6
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.362) question?
Stock #R7972 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location74675013-74677705 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 74675925 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 227 (R227L)
Ref Sequence ENSEMBL: ENSMUSP00000001878 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001872] [ENSMUST00000001878]
Predicted Effect probably benign
Transcript: ENSMUST00000001872
SMART Domains Protein: ENSMUSP00000001872
Gene: ENSMUSG00000001819

DomainStartEndE-ValueType
low complexity region 14 34 N/A INTRINSIC
Pfam:HoxA13_N 75 177 4e-18 PFAM
HOX 272 334 4.33e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000001878
AA Change: R227L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000001878
Gene: ENSMUSG00000001823
AA Change: R227L

DomainStartEndE-ValueType
HOX 200 262 4.57e-21 SMART
Meta Mutation Damage Score 0.6329 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the homeobox family of genes. The homeobox genes encode a highly conserved family of transcription factors that play an important role in morphogenesis in all multicellular organisms. Mammals possess four similar homeobox gene clusters, HOXA, HOXB, HOXC and HOXD, located on different chromosomes, consisting of 9 to 11 genes arranged in tandem. This gene is one of several homeobox HOXD genes located in a cluster on chromosome 2. Deletions that remove the entire HOXD gene cluster or the 5' end of this cluster have been associated with severe limb and genital abnormalities. The exact role of this gene has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit minor forelimb defects affecting carpals, metacarpals, and phalanges, and alterations of smooth muscle layers of the rectum resulting in malformation of the internal anal sphincter. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd16a T A 17: 35,101,311 V384E probably damaging Het
Acacb C T 5: 114,226,857 R1533* probably null Het
Alox12 T A 11: 70,242,687 M604L probably benign Het
Amotl2 C T 9: 102,723,769 T345I probably benign Het
Brdt A T 5: 107,348,549 I176F possibly damaging Het
Cdk5 G T 5: 24,419,658 T245K probably benign Het
Chd9 A T 8: 91,005,767 R1304S unknown Het
Clpsl2 G A 17: 28,550,728 G55R probably damaging Het
Cyp2j11 T A 4: 96,297,634 E438V probably damaging Het
Dao AGG AG 5: 114,015,209 probably benign Het
Dnah10 T C 5: 124,726,885 V92A probably benign Het
Dusp27 T A 1: 166,099,139 E968V probably damaging Het
Evl C T 12: 108,681,524 R295* probably null Het
Fam184a A T 10: 53,638,259 L1022Q probably damaging Het
Foxd4 T C 19: 24,900,230 H202R probably damaging Het
Fry T C 5: 150,310,396 V16A probably benign Het
Gstcd A T 3: 133,072,133 F306I probably benign Het
Hist1h2bl A G 13: 21,715,807 S113P possibly damaging Het
Hivep3 T C 4: 120,097,514 V1009A possibly damaging Het
Ifi208 T A 1: 173,678,990 M113K possibly damaging Het
Kcnh4 T G 11: 100,752,452 T330P probably damaging Het
Kctd17 CAGCTGGAGGAGC CAGC 15: 78,436,913 probably benign Het
Lin28a G A 4: 134,006,263 P158S probably damaging Het
Muc16 C A 9: 18,645,764 E3078* probably null Het
Naaladl1 A G 19: 6,106,244 N120S probably damaging Het
Nol10 G A 12: 17,352,647 R40H probably benign Het
Ntng1 G A 3: 110,135,486 S8L probably benign Het
Olfr1212 T A 2: 88,958,833 Y122* probably null Het
Olfr1243 T G 2: 89,527,604 I269L probably benign Het
Pacsin1 T A 17: 27,708,639 F319I unknown Het
Pla2g4d G A 2: 120,278,932 T212I probably benign Het
Ppp4r1 T A 17: 65,833,098 C664S possibly damaging Het
Prodh2 T C 7: 30,511,155 I377T probably damaging Het
Prss57 A T 10: 79,783,396 L243H probably benign Het
Pxdn C T 12: 30,006,602 L1271F probably damaging Het
Ros1 G A 10: 52,154,830 R581* probably null Het
Rps6kc1 C T 1: 190,799,124 G894S probably benign Het
Sirt7 A G 11: 120,619,190 S183P unknown Het
Slc12a4 G A 8: 105,951,605 R319W possibly damaging Het
Son AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,334 probably benign Het
Tbc1d8 A G 1: 39,392,169 F374S probably damaging Het
Tdrd1 T A 19: 56,848,702 D489E probably damaging Het
Tiprl T A 1: 165,236,974 probably benign Het
Tpt1 T C 14: 75,848,099 *173Q probably null Het
Trim17 A G 11: 58,968,568 I203V probably benign Het
Trim43b T A 9: 89,091,308 H124L probably damaging Het
Triobp T C 15: 78,967,986 I780T probably damaging Het
Ttc30a1 A T 2: 75,980,458 M427K probably damaging Het
Tyrobp G A 7: 30,414,638 G101R Het
Vmn1r181 A T 7: 23,984,446 H112L probably benign Het
Wdr19 A G 5: 65,223,850 N406D probably damaging Het
Zc3h12a T C 4: 125,119,935 K379E probably benign Het
Zcwpw1 T C 5: 137,801,061 I230T probably benign Het
Zfhx4 A G 3: 5,412,473 T3383A probably benign Het
Other mutations in Hoxd12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Hoxd12 APN 2 74675427 missense probably damaging 1.00
IGL01324:Hoxd12 APN 2 74675136 missense probably damaging 1.00
IGL02229:Hoxd12 APN 2 74675934 missense probably damaging 1.00
IGL02684:Hoxd12 APN 2 74675561 missense probably benign
R0661:Hoxd12 UTSW 2 74675892 missense probably damaging 0.98
R0975:Hoxd12 UTSW 2 74675934 missense probably damaging 1.00
R1931:Hoxd12 UTSW 2 74675513 missense probably benign
R1931:Hoxd12 UTSW 2 74675531 missense probably benign 0.00
R2510:Hoxd12 UTSW 2 74675471 missense possibly damaging 0.56
R2511:Hoxd12 UTSW 2 74675471 missense possibly damaging 0.56
R3946:Hoxd12 UTSW 2 74675427 missense probably damaging 1.00
R5194:Hoxd12 UTSW 2 74675103 missense probably damaging 1.00
R7326:Hoxd12 UTSW 2 74675246 missense possibly damaging 0.48
R7426:Hoxd12 UTSW 2 74675225 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- TGTCAGGGACAGTTGGACAG -3'
(R):5'- TCCTCAGCTACAGACTGAGC -3'

Sequencing Primer
(F):5'- CAGCAGTGGTGAACGTCTG -3'
(R):5'- CCAGGCCTTGGTCCAAAAG -3'
Posted On2020-09-15