Incidental Mutation 'R7972:Olfr1212'
ID650641
Institutional Source Beutler Lab
Gene Symbol Olfr1212
Ensembl Gene ENSMUSG00000048226
Gene Nameolfactory receptor 1212
SynonymsGA_x6K02T2Q125-50437014-50437949, MOR233-20, MOR233-17
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R7972 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location88953969-88961313 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 88958833 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 122 (Y122*)
Ref Sequence ENSEMBL: ENSMUSP00000149781 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055895] [ENSMUST00000215781]
Predicted Effect probably null
Transcript: ENSMUST00000055895
AA Change: Y122*
SMART Domains Protein: ENSMUSP00000052837
Gene: ENSMUSG00000048226
AA Change: Y122*

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 1.9e-46 PFAM
Pfam:7tm_1 39 286 7.1e-15 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000215781
AA Change: Y122*
Meta Mutation Damage Score 0.9718 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd16a T A 17: 35,101,311 V384E probably damaging Het
Acacb C T 5: 114,226,857 R1533* probably null Het
Alox12 T A 11: 70,242,687 M604L probably benign Het
Amotl2 C T 9: 102,723,769 T345I probably benign Het
Brdt A T 5: 107,348,549 I176F possibly damaging Het
Cdk5 G T 5: 24,419,658 T245K probably benign Het
Chd9 A T 8: 91,005,767 R1304S unknown Het
Clpsl2 G A 17: 28,550,728 G55R probably damaging Het
Cyp2j11 T A 4: 96,297,634 E438V probably damaging Het
Dao AGG AG 5: 114,015,209 probably benign Het
Dnah10 T C 5: 124,726,885 V92A probably benign Het
Dusp27 T A 1: 166,099,139 E968V probably damaging Het
Evl C T 12: 108,681,524 R295* probably null Het
Fam184a A T 10: 53,638,259 L1022Q probably damaging Het
Foxd4 T C 19: 24,900,230 H202R probably damaging Het
Fry T C 5: 150,310,396 V16A probably benign Het
Gstcd A T 3: 133,072,133 F306I probably benign Het
Hist1h2bl A G 13: 21,715,807 S113P possibly damaging Het
Hivep3 T C 4: 120,097,514 V1009A possibly damaging Het
Hoxd12 G T 2: 74,675,925 R227L probably damaging Het
Ifi208 T A 1: 173,678,990 M113K possibly damaging Het
Kcnh4 T G 11: 100,752,452 T330P probably damaging Het
Kctd17 CAGCTGGAGGAGC CAGC 15: 78,436,913 probably benign Het
Lin28a G A 4: 134,006,263 P158S probably damaging Het
Muc16 C A 9: 18,645,764 E3078* probably null Het
Naaladl1 A G 19: 6,106,244 N120S probably damaging Het
Nol10 G A 12: 17,352,647 R40H probably benign Het
Ntng1 G A 3: 110,135,486 S8L probably benign Het
Olfr1243 T G 2: 89,527,604 I269L probably benign Het
Pacsin1 T A 17: 27,708,639 F319I unknown Het
Pla2g4d G A 2: 120,278,932 T212I probably benign Het
Ppp4r1 T A 17: 65,833,098 C664S possibly damaging Het
Prodh2 T C 7: 30,511,155 I377T probably damaging Het
Prss57 A T 10: 79,783,396 L243H probably benign Het
Pxdn C T 12: 30,006,602 L1271F probably damaging Het
Ros1 G A 10: 52,154,830 R581* probably null Het
Rps6kc1 C T 1: 190,799,124 G894S probably benign Het
Sirt7 A G 11: 120,619,190 S183P unknown Het
Slc12a4 G A 8: 105,951,605 R319W possibly damaging Het
Son AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,334 probably benign Het
Tbc1d8 A G 1: 39,392,169 F374S probably damaging Het
Tdrd1 T A 19: 56,848,702 D489E probably damaging Het
Tiprl T A 1: 165,236,974 probably benign Het
Tpt1 T C 14: 75,848,099 *173Q probably null Het
Trim17 A G 11: 58,968,568 I203V probably benign Het
Trim43b T A 9: 89,091,308 H124L probably damaging Het
Triobp T C 15: 78,967,986 I780T probably damaging Het
Ttc30a1 A T 2: 75,980,458 M427K probably damaging Het
Tyrobp G A 7: 30,414,638 G101R Het
Vmn1r181 A T 7: 23,984,446 H112L probably benign Het
Wdr19 A G 5: 65,223,850 N406D probably damaging Het
Zc3h12a T C 4: 125,119,935 K379E probably benign Het
Zcwpw1 T C 5: 137,801,061 I230T probably benign Het
Zfhx4 A G 3: 5,412,473 T3383A probably benign Het
Other mutations in Olfr1212
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Olfr1212 APN 2 88958766 missense probably damaging 0.98
IGL01398:Olfr1212 APN 2 88958849 missense probably damaging 1.00
IGL01537:Olfr1212 APN 2 88958541 missense probably benign 0.00
IGL02197:Olfr1212 APN 2 88958684 missense probably benign 0.05
IGL02557:Olfr1212 APN 2 88958681 missense probably benign 0.00
R0276:Olfr1212 UTSW 2 88958755 nonsense probably null
R0568:Olfr1212 UTSW 2 88959043 nonsense probably null
R0699:Olfr1212 UTSW 2 88958616 missense probably benign 0.31
R1101:Olfr1212 UTSW 2 88958984 missense possibly damaging 0.60
R1205:Olfr1212 UTSW 2 88958588 missense probably benign 0.00
R1468:Olfr1212 UTSW 2 88959043 nonsense probably null
R1468:Olfr1212 UTSW 2 88959043 nonsense probably null
R1845:Olfr1212 UTSW 2 88958867 missense probably damaging 0.99
R2031:Olfr1212 UTSW 2 88959299 missense probably benign 0.19
R2418:Olfr1212 UTSW 2 88959036 missense probably benign 0.01
R2419:Olfr1212 UTSW 2 88959036 missense probably benign 0.01
R3781:Olfr1212 UTSW 2 88958747 nonsense probably null
R4049:Olfr1212 UTSW 2 88959273 missense probably benign 0.09
R4440:Olfr1212 UTSW 2 88959341 missense probably benign 0.22
R4583:Olfr1212 UTSW 2 88959212 missense probably damaging 0.99
R4646:Olfr1212 UTSW 2 88959212 missense probably damaging 0.99
R4648:Olfr1212 UTSW 2 88959212 missense probably damaging 0.99
R4674:Olfr1212 UTSW 2 88958872 missense probably damaging 0.98
R4851:Olfr1212 UTSW 2 88958586 missense probably damaging 1.00
R4971:Olfr1212 UTSW 2 88958519 missense probably damaging 1.00
R5610:Olfr1212 UTSW 2 88958826 missense probably damaging 1.00
R5805:Olfr1212 UTSW 2 88958641 missense possibly damaging 0.50
R5887:Olfr1212 UTSW 2 88958754 missense possibly damaging 0.60
R6023:Olfr1212 UTSW 2 88958715 missense possibly damaging 0.76
R6118:Olfr1212 UTSW 2 88959118 nonsense probably null
R7490:Olfr1212 UTSW 2 88959048 missense probably benign 0.00
R7542:Olfr1212 UTSW 2 88958775 missense probably benign 0.01
R7612:Olfr1212 UTSW 2 88958505 missense probably damaging 1.00
R8422:Olfr1212 UTSW 2 88958997 missense probably benign 0.05
Z1177:Olfr1212 UTSW 2 88959377 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTGCTTGGATCACCCATGTAC -3'
(R):5'- ATGCCAACTCCAGTAATGGG -3'

Sequencing Primer
(F):5'- GGATCACCCATGTACTTCTTCTTGG -3'
(R):5'- TCCAGTAATGGGAACAAGTCACAC -3'
Posted On2020-09-15