Incidental Mutation 'R7972:Gstcd'
ID650646
Institutional Source Beutler Lab
Gene Symbol Gstcd
Ensembl Gene ENSMUSG00000028018
Gene Nameglutathione S-transferase, C-terminal domain containing
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7972 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location132981752-133092033 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 133072133 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 306 (F306I)
Ref Sequence ENSEMBL: ENSMUSP00000029651 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029651] [ENSMUST00000080583]
Predicted Effect probably benign
Transcript: ENSMUST00000029651
AA Change: F306I

PolyPhen 2 Score 0.101 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000029651
Gene: ENSMUSG00000028018
AA Change: F306I

DomainStartEndE-ValueType
low complexity region 52 62 N/A INTRINSIC
low complexity region 168 181 N/A INTRINSIC
low complexity region 195 205 N/A INTRINSIC
low complexity region 208 229 N/A INTRINSIC
Pfam:GidB 417 515 9e-9 PFAM
Pfam:Methyltransf_32 424 548 1.1e-15 PFAM
Pfam:MTS 430 508 5.3e-6 PFAM
Pfam:Methyltransf_31 440 571 2.6e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000080583
AA Change: F306I

PolyPhen 2 Score 0.101 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000079421
Gene: ENSMUSG00000028018
AA Change: F306I

DomainStartEndE-ValueType
low complexity region 52 62 N/A INTRINSIC
low complexity region 168 181 N/A INTRINSIC
low complexity region 195 205 N/A INTRINSIC
low complexity region 208 229 N/A INTRINSIC
Pfam:GidB 418 516 1.5e-8 PFAM
Pfam:Methyltransf_32 424 548 1.1e-15 PFAM
Pfam:Methyltransf_31 440 569 2.5e-11 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (48/49)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd16a T A 17: 35,101,311 V384E probably damaging Het
Acacb C T 5: 114,226,857 R1533* probably null Het
Alox12 T A 11: 70,242,687 M604L probably benign Het
Amotl2 C T 9: 102,723,769 T345I probably benign Het
Brdt A T 5: 107,348,549 I176F possibly damaging Het
Cdk5 G T 5: 24,419,658 T245K probably benign Het
Chd9 A T 8: 91,005,767 R1304S unknown Het
Clpsl2 G A 17: 28,550,728 G55R probably damaging Het
Cyp2j11 T A 4: 96,297,634 E438V probably damaging Het
Dao AGG AG 5: 114,015,209 probably benign Het
Dnah10 T C 5: 124,726,885 V92A probably benign Het
Dusp27 T A 1: 166,099,139 E968V probably damaging Het
Evl C T 12: 108,681,524 R295* probably null Het
Fam184a A T 10: 53,638,259 L1022Q probably damaging Het
Foxd4 T C 19: 24,900,230 H202R probably damaging Het
Fry T C 5: 150,310,396 V16A probably benign Het
Hist1h2bl A G 13: 21,715,807 S113P possibly damaging Het
Hivep3 T C 4: 120,097,514 V1009A possibly damaging Het
Hoxd12 G T 2: 74,675,925 R227L probably damaging Het
Ifi208 T A 1: 173,678,990 M113K possibly damaging Het
Kcnh4 T G 11: 100,752,452 T330P probably damaging Het
Kctd17 CAGCTGGAGGAGC CAGC 15: 78,436,913 probably benign Het
Lin28a G A 4: 134,006,263 P158S probably damaging Het
Muc16 C A 9: 18,645,764 E3078* probably null Het
Naaladl1 A G 19: 6,106,244 N120S probably damaging Het
Nol10 G A 12: 17,352,647 R40H probably benign Het
Ntng1 G A 3: 110,135,486 S8L probably benign Het
Olfr1212 T A 2: 88,958,833 Y122* probably null Het
Olfr1243 T G 2: 89,527,604 I269L probably benign Het
Pacsin1 T A 17: 27,708,639 F319I unknown Het
Pla2g4d G A 2: 120,278,932 T212I probably benign Het
Ppp4r1 T A 17: 65,833,098 C664S possibly damaging Het
Prodh2 T C 7: 30,511,155 I377T probably damaging Het
Prss57 A T 10: 79,783,396 L243H probably benign Het
Pxdn C T 12: 30,006,602 L1271F probably damaging Het
Ros1 G A 10: 52,154,830 R581* probably null Het
Rps6kc1 C T 1: 190,799,124 G894S probably benign Het
Sirt7 A G 11: 120,619,190 S183P unknown Het
Slc12a4 G A 8: 105,951,605 R319W possibly damaging Het
Son AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,334 probably benign Het
Tbc1d8 A G 1: 39,392,169 F374S probably damaging Het
Tdrd1 T A 19: 56,848,702 D489E probably damaging Het
Tiprl T A 1: 165,236,974 probably benign Het
Tpt1 T C 14: 75,848,099 *173Q probably null Het
Trim17 A G 11: 58,968,568 I203V probably benign Het
Trim43b T A 9: 89,091,308 H124L probably damaging Het
Triobp T C 15: 78,967,986 I780T probably damaging Het
Ttc30a1 A T 2: 75,980,458 M427K probably damaging Het
Tyrobp G A 7: 30,414,638 G101R Het
Vmn1r181 A T 7: 23,984,446 H112L probably benign Het
Wdr19 A G 5: 65,223,850 N406D probably damaging Het
Zc3h12a T C 4: 125,119,935 K379E probably benign Het
Zcwpw1 T C 5: 137,801,061 I230T probably benign Het
Zfhx4 A G 3: 5,412,473 T3383A probably benign Het
Other mutations in Gstcd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01540:Gstcd APN 3 132986414 missense probably damaging 0.96
IGL01800:Gstcd APN 3 133084574 critical splice donor site probably null
IGL02434:Gstcd APN 3 132996202 splice site probably benign
IGL02720:Gstcd APN 3 133071961 missense probably benign 0.00
R0367:Gstcd UTSW 3 132986377 splice site probably benign
R0378:Gstcd UTSW 3 132986408 missense probably damaging 1.00
R0382:Gstcd UTSW 3 132986408 missense probably damaging 1.00
R0465:Gstcd UTSW 3 132983144 missense probably benign 0.04
R1295:Gstcd UTSW 3 133005628 missense probably damaging 1.00
R1861:Gstcd UTSW 3 132983107 missense probably damaging 1.00
R2056:Gstcd UTSW 3 133082053 missense probably benign 0.00
R2331:Gstcd UTSW 3 132998880 missense probably damaging 0.98
R2513:Gstcd UTSW 3 133082320 missense possibly damaging 0.59
R2513:Gstcd UTSW 3 133082321 missense possibly damaging 0.87
R3547:Gstcd UTSW 3 133084838 missense possibly damaging 0.86
R4022:Gstcd UTSW 3 133082068 missense probably damaging 1.00
R4713:Gstcd UTSW 3 132983099 missense probably damaging 1.00
R4877:Gstcd UTSW 3 133005553 splice site probably benign
R5152:Gstcd UTSW 3 133084956 missense possibly damaging 0.95
R5165:Gstcd UTSW 3 133084679 missense probably damaging 0.99
R6106:Gstcd UTSW 3 132998914 missense probably benign 0.02
R6177:Gstcd UTSW 3 133082073 missense probably damaging 1.00
R7100:Gstcd UTSW 3 133084943 missense probably benign 0.01
R7264:Gstcd UTSW 3 133084779 missense probably benign 0.00
R7785:Gstcd UTSW 3 133082107 missense probably damaging 0.99
R7786:Gstcd UTSW 3 133082107 missense probably damaging 0.99
R7975:Gstcd UTSW 3 133072102 missense probably damaging 1.00
R8029:Gstcd UTSW 3 133082107 missense probably damaging 0.99
R8036:Gstcd UTSW 3 133082107 missense probably damaging 0.99
R8088:Gstcd UTSW 3 133082107 missense probably damaging 0.99
R8716:Gstcd UTSW 3 132983189 missense probably damaging 1.00
R8722:Gstcd UTSW 3 133072061 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAGGGTCACTTTGCTCATCTAC -3'
(R):5'- CAAACTGTTACAGCGTTGTGG -3'

Sequencing Primer
(F):5'- ACAGCTGCTACTTCATCAGAATTC -3'
(R):5'- TTGTACCTTTGAGATGTGTAA -3'
Posted On2020-09-15