Incidental Mutation 'R7972:Zc3h12a'
ID650649
Institutional Source Beutler Lab
Gene Symbol Zc3h12a
Ensembl Gene ENSMUSG00000042677
Gene Namezinc finger CCCH type containing 12A
SynonymsMcpip1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.786) question?
Stock #R7972 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location125118423-125127840 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 125119935 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 379 (K379E)
Ref Sequence ENSEMBL: ENSMUSP00000037172 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036188]
Predicted Effect probably benign
Transcript: ENSMUST00000036188
AA Change: K379E

PolyPhen 2 Score 0.434 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000037172
Gene: ENSMUSG00000042677
AA Change: K379E

DomainStartEndE-ValueType
Pfam:RNase_Zc3h12a 134 290 3.2e-66 PFAM
low complexity region 354 368 N/A INTRINSIC
low complexity region 476 487 N/A INTRINSIC
low complexity region 494 508 N/A INTRINSIC
low complexity region 514 544 N/A INTRINSIC
Meta Mutation Damage Score 0.0665 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ZC3H12A is an MCP1 (CCL2; MIM 158105)-induced protein that acts as a transcriptional activator and causes cell death of cardiomyocytes, possibly via induction of genes associated with apoptosis.[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit splenomegaly, lymphadenopathy, hyperimmunoglobulinemia, increased auto-antibodies, and defective IL6 post-transcriptional regulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd16a T A 17: 35,101,311 V384E probably damaging Het
Acacb C T 5: 114,226,857 R1533* probably null Het
Alox12 T A 11: 70,242,687 M604L probably benign Het
Amotl2 C T 9: 102,723,769 T345I probably benign Het
Brdt A T 5: 107,348,549 I176F possibly damaging Het
Cdk5 G T 5: 24,419,658 T245K probably benign Het
Chd9 A T 8: 91,005,767 R1304S unknown Het
Clpsl2 G A 17: 28,550,728 G55R probably damaging Het
Cyp2j11 T A 4: 96,297,634 E438V probably damaging Het
Dao AGG AG 5: 114,015,209 probably benign Het
Dnah10 T C 5: 124,726,885 V92A probably benign Het
Dusp27 T A 1: 166,099,139 E968V probably damaging Het
Evl C T 12: 108,681,524 R295* probably null Het
Fam184a A T 10: 53,638,259 L1022Q probably damaging Het
Foxd4 T C 19: 24,900,230 H202R probably damaging Het
Fry T C 5: 150,310,396 V16A probably benign Het
Gstcd A T 3: 133,072,133 F306I probably benign Het
Hist1h2bl A G 13: 21,715,807 S113P possibly damaging Het
Hivep3 T C 4: 120,097,514 V1009A possibly damaging Het
Hoxd12 G T 2: 74,675,925 R227L probably damaging Het
Ifi208 T A 1: 173,678,990 M113K possibly damaging Het
Kcnh4 T G 11: 100,752,452 T330P probably damaging Het
Kctd17 CAGCTGGAGGAGC CAGC 15: 78,436,913 probably benign Het
Lin28a G A 4: 134,006,263 P158S probably damaging Het
Muc16 C A 9: 18,645,764 E3078* probably null Het
Naaladl1 A G 19: 6,106,244 N120S probably damaging Het
Nol10 G A 12: 17,352,647 R40H probably benign Het
Ntng1 G A 3: 110,135,486 S8L probably benign Het
Olfr1212 T A 2: 88,958,833 Y122* probably null Het
Olfr1243 T G 2: 89,527,604 I269L probably benign Het
Pacsin1 T A 17: 27,708,639 F319I unknown Het
Pla2g4d G A 2: 120,278,932 T212I probably benign Het
Ppp4r1 T A 17: 65,833,098 C664S possibly damaging Het
Prodh2 T C 7: 30,511,155 I377T probably damaging Het
Prss57 A T 10: 79,783,396 L243H probably benign Het
Pxdn C T 12: 30,006,602 L1271F probably damaging Het
Ros1 G A 10: 52,154,830 R581* probably null Het
Rps6kc1 C T 1: 190,799,124 G894S probably benign Het
Sirt7 A G 11: 120,619,190 S183P unknown Het
Slc12a4 G A 8: 105,951,605 R319W possibly damaging Het
Son AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,334 probably benign Het
Tbc1d8 A G 1: 39,392,169 F374S probably damaging Het
Tdrd1 T A 19: 56,848,702 D489E probably damaging Het
Tiprl T A 1: 165,236,974 probably benign Het
Tpt1 T C 14: 75,848,099 *173Q probably null Het
Trim17 A G 11: 58,968,568 I203V probably benign Het
Trim43b T A 9: 89,091,308 H124L probably damaging Het
Triobp T C 15: 78,967,986 I780T probably damaging Het
Ttc30a1 A T 2: 75,980,458 M427K probably damaging Het
Tyrobp G A 7: 30,414,638 G101R Het
Vmn1r181 A T 7: 23,984,446 H112L probably benign Het
Wdr19 A G 5: 65,223,850 N406D probably damaging Het
Zcwpw1 T C 5: 137,801,061 I230T probably benign Het
Zfhx4 A G 3: 5,412,473 T3383A probably benign Het
Other mutations in Zc3h12a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01928:Zc3h12a APN 4 125119986 missense probably benign 0.00
IGL02419:Zc3h12a APN 4 125119788 missense probably benign
IGL03085:Zc3h12a APN 4 125127020 missense probably benign 0.19
IGL03181:Zc3h12a APN 4 125119304 missense probably damaging 1.00
I1329:Zc3h12a UTSW 4 125119364 missense possibly damaging 0.85
P0022:Zc3h12a UTSW 4 125119409 missense possibly damaging 0.69
R2084:Zc3h12a UTSW 4 125120009 missense probably benign 0.00
R2149:Zc3h12a UTSW 4 125126642 missense possibly damaging 0.77
R2404:Zc3h12a UTSW 4 125119523 missense probably damaging 1.00
R3862:Zc3h12a UTSW 4 125126939 missense probably benign
R3891:Zc3h12a UTSW 4 125126885 missense probably damaging 1.00
R4707:Zc3h12a UTSW 4 125120893 missense probably damaging 1.00
R5215:Zc3h12a UTSW 4 125126913 missense probably benign 0.17
R5283:Zc3h12a UTSW 4 125126765 missense probably benign 0.11
R5570:Zc3h12a UTSW 4 125120373 missense probably damaging 1.00
R8311:Zc3h12a UTSW 4 125126995 missense possibly damaging 0.95
R8516:Zc3h12a UTSW 4 125119839 missense probably damaging 0.99
R8872:Zc3h12a UTSW 4 125126619 missense probably damaging 1.00
X0026:Zc3h12a UTSW 4 125126871 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGCCCCATAATTCTGACATCTG -3'
(R):5'- ACGTATGGAATCAAGTGCCG -3'

Sequencing Primer
(F):5'- GGAACCAATGCCTGAATCAAGGC -3'
(R):5'- GGAATCAAGTGCCGATTTTTCCAC -3'
Posted On2020-09-15