Incidental Mutation 'R7972:Lin28a'
ID650650
Institutional Source Beutler Lab
Gene Symbol Lin28a
Ensembl Gene ENSMUSG00000050966
Gene Namelin-28 homolog A (C. elegans)
SynonymsLin-28, Tex17, Lin28a, Lin28
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7972 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location134003330-134018841 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 134006263 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 158 (P158S)
Ref Sequence ENSEMBL: ENSMUSP00000050488 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051674] [ENSMUST00000176113] [ENSMUST00000176292] [ENSMUST00000176897]
PDB Structure Mouse Lin28A in complex with let-7d microRNA pre-element [X-RAY DIFFRACTION]
Mouse Lin28A in complex with let-7f-1 microRNA pre-element [X-RAY DIFFRACTION]
Mouse Lin28A in complex with let-7g microRNA pre-element [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000051674
AA Change: P158S

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000050488
Gene: ENSMUSG00000050966
AA Change: P158S

DomainStartEndE-ValueType
low complexity region 14 35 N/A INTRINSIC
CSP 41 112 5.63e-14 SMART
ZnF_C2HC 138 154 1.91e-2 SMART
ZnF_C2HC 160 176 4.92e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000176113
AA Change: P78S

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000135254
Gene: ENSMUSG00000050966
AA Change: P78S

DomainStartEndE-ValueType
Pfam:CSD 1 32 1.9e-7 PFAM
ZnF_C2HC 58 74 1.91e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000176292
AA Change: P78S

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000135608
Gene: ENSMUSG00000050966
AA Change: P78S

DomainStartEndE-ValueType
Pfam:CSD 1 32 1.8e-7 PFAM
ZnF_C2HC 58 74 1.91e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176897
SMART Domains Protein: ENSMUSP00000135736
Gene: ENSMUSG00000050966

DomainStartEndE-ValueType
Pfam:CSD 1 62 5.8e-15 PFAM
Meta Mutation Damage Score 0.1100 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a LIN-28 family RNA-binding protein that acts as a posttranscriptional regulator of genes involved in developmental timing and self-renewal in embryonic stem cells. The encoded protein functions through direct interaction with target mRNAs and by disrupting the maturation of certain miRNAs involved in embryonic development. This protein prevents the terminal processing of the LET7 family of microRNAs which are major regulators of cellular growth and differentiation. Aberrant expression of this gene is associated with cancer progression in multiple tissues. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased birth weight and postnatal lethality. In another report, mice homozygous for the same or an identical allele exhibit reduced premordial germ cells and fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd16a T A 17: 35,101,311 V384E probably damaging Het
Acacb C T 5: 114,226,857 R1533* probably null Het
Alox12 T A 11: 70,242,687 M604L probably benign Het
Amotl2 C T 9: 102,723,769 T345I probably benign Het
Brdt A T 5: 107,348,549 I176F possibly damaging Het
Cdk5 G T 5: 24,419,658 T245K probably benign Het
Chd9 A T 8: 91,005,767 R1304S unknown Het
Clpsl2 G A 17: 28,550,728 G55R probably damaging Het
Cyp2j11 T A 4: 96,297,634 E438V probably damaging Het
Dao AGG AG 5: 114,015,209 probably benign Het
Dnah10 T C 5: 124,726,885 V92A probably benign Het
Dusp27 T A 1: 166,099,139 E968V probably damaging Het
Evl C T 12: 108,681,524 R295* probably null Het
Fam184a A T 10: 53,638,259 L1022Q probably damaging Het
Foxd4 T C 19: 24,900,230 H202R probably damaging Het
Fry T C 5: 150,310,396 V16A probably benign Het
Gstcd A T 3: 133,072,133 F306I probably benign Het
Hist1h2bl A G 13: 21,715,807 S113P possibly damaging Het
Hivep3 T C 4: 120,097,514 V1009A possibly damaging Het
Hoxd12 G T 2: 74,675,925 R227L probably damaging Het
Ifi208 T A 1: 173,678,990 M113K possibly damaging Het
Kcnh4 T G 11: 100,752,452 T330P probably damaging Het
Kctd17 CAGCTGGAGGAGC CAGC 15: 78,436,913 probably benign Het
Muc16 C A 9: 18,645,764 E3078* probably null Het
Naaladl1 A G 19: 6,106,244 N120S probably damaging Het
Nol10 G A 12: 17,352,647 R40H probably benign Het
Ntng1 G A 3: 110,135,486 S8L probably benign Het
Olfr1212 T A 2: 88,958,833 Y122* probably null Het
Olfr1243 T G 2: 89,527,604 I269L probably benign Het
Pacsin1 T A 17: 27,708,639 F319I unknown Het
Pla2g4d G A 2: 120,278,932 T212I probably benign Het
Ppp4r1 T A 17: 65,833,098 C664S possibly damaging Het
Prodh2 T C 7: 30,511,155 I377T probably damaging Het
Prss57 A T 10: 79,783,396 L243H probably benign Het
Pxdn C T 12: 30,006,602 L1271F probably damaging Het
Ros1 G A 10: 52,154,830 R581* probably null Het
Rps6kc1 C T 1: 190,799,124 G894S probably benign Het
Sirt7 A G 11: 120,619,190 S183P unknown Het
Slc12a4 G A 8: 105,951,605 R319W possibly damaging Het
Son AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,334 probably benign Het
Tbc1d8 A G 1: 39,392,169 F374S probably damaging Het
Tdrd1 T A 19: 56,848,702 D489E probably damaging Het
Tiprl T A 1: 165,236,974 probably benign Het
Tpt1 T C 14: 75,848,099 *173Q probably null Het
Trim17 A G 11: 58,968,568 I203V probably benign Het
Trim43b T A 9: 89,091,308 H124L probably damaging Het
Triobp T C 15: 78,967,986 I780T probably damaging Het
Ttc30a1 A T 2: 75,980,458 M427K probably damaging Het
Tyrobp G A 7: 30,414,638 G101R Het
Vmn1r181 A T 7: 23,984,446 H112L probably benign Het
Wdr19 A G 5: 65,223,850 N406D probably damaging Het
Zc3h12a T C 4: 125,119,935 K379E probably benign Het
Zcwpw1 T C 5: 137,801,061 I230T probably benign Het
Zfhx4 A G 3: 5,412,473 T3383A probably benign Het
Other mutations in Lin28a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00809:Lin28a APN 4 134008056 missense probably damaging 1.00
IGL01515:Lin28a APN 4 134018709 critical splice donor site probably null
IGL01725:Lin28a APN 4 134007930 nonsense probably null
R0659:Lin28a UTSW 4 134008099 splice site probably benign
R0730:Lin28a UTSW 4 134008008 missense probably damaging 1.00
R2129:Lin28a UTSW 4 134018154 missense probably benign 0.00
R3196:Lin28a UTSW 4 134007924 missense possibly damaging 0.80
R4998:Lin28a UTSW 4 134018717 missense possibly damaging 0.73
R5734:Lin28a UTSW 4 134007973 nonsense probably null
R6540:Lin28a UTSW 4 134018061 missense possibly damaging 0.85
R7012:Lin28a UTSW 4 134018729 missense probably damaging 1.00
R7226:Lin28a UTSW 4 134006308 missense probably damaging 1.00
R8072:Lin28a UTSW 4 134018142 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- TCCACTCTGCAGATTGATGCC -3'
(R):5'- TTCAAAAGCAGGAAATAGGTCACC -3'

Sequencing Primer
(F):5'- GCAGATTGATGCCTCTTTCCTTAAAC -3'
(R):5'- TAGGTCACCAGGGAGGCG -3'
Posted On2020-09-15