Incidental Mutation 'R7972:Brdt'
ID 650653
Institutional Source Beutler Lab
Gene Symbol Brdt
Ensembl Gene ENSMUSG00000029279
Gene Name bromodomain, testis-specific
Synonyms 7420412D09Rik, Brd6, Fsrg3
MMRRC Submission 046015-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7972 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 107479025-107534924 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 107496415 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 176 (I176F)
Ref Sequence ENSEMBL: ENSMUSP00000031215 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031215] [ENSMUST00000112677]
AlphaFold Q91Y44
PDB Structure Structure of Brdt bromodomain 2 bound to an acetylated histone H3 peptide [X-RAY DIFFRACTION]
Structure of Brdt bromodomain BD1 bound to a diacetylated histone H4 peptide. [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031215
AA Change: I176F

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000031215
Gene: ENSMUSG00000029279
AA Change: I176F

DomainStartEndE-ValueType
BROMO 24 134 2.7e-45 SMART
BROMO 268 377 2.18e-40 SMART
low complexity region 392 417 N/A INTRINSIC
low complexity region 446 455 N/A INTRINSIC
low complexity region 472 500 N/A INTRINSIC
Pfam:BET 505 569 9.2e-34 PFAM
low complexity region 585 603 N/A INTRINSIC
low complexity region 649 691 N/A INTRINSIC
low complexity region 895 909 N/A INTRINSIC
Pfam:BRD4_CDT 913 956 3e-26 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000112677
AA Change: I176F

PolyPhen 2 Score 0.851 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000108297
Gene: ENSMUSG00000029279
AA Change: I176F

DomainStartEndE-ValueType
BROMO 24 134 2.7e-45 SMART
Pfam:Bromodomain 275 326 2.7e-8 PFAM
Meta Mutation Damage Score 0.0935 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: The protein encoded by this gene belongs to the BET protein family. BET proteins have two N-terminal bromodomains and one C-terminal extraterminal domain (ET domain). BET proteins regulate chromatin reorganization via binding to acetylated histones. This gene is thought to play a role in the transcriptional regulation of spermatogenesis. Although referred to as testis-specific bromodomain (Brdt) protein, RT-PCR indicates that this gene is expressed in both mouse oocytes and testes. Alternative splicing results in multiple transcript variants encoding different proteins. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this genes leads to arrest of spermatogenesis and male infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd16a T A 17: 35,320,287 (GRCm39) V384E probably damaging Het
Acacb C T 5: 114,364,918 (GRCm39) R1533* probably null Het
Alox12 T A 11: 70,133,513 (GRCm39) M604L probably benign Het
Amotl2 C T 9: 102,600,968 (GRCm39) T345I probably benign Het
Cdk5 G T 5: 24,624,656 (GRCm39) T245K probably benign Het
Chd9 A T 8: 91,732,395 (GRCm39) R1304S unknown Het
Clpsl2 G A 17: 28,769,702 (GRCm39) G55R probably damaging Het
Cyp2j11 T A 4: 96,185,871 (GRCm39) E438V probably damaging Het
Dao AGG AG 5: 114,153,270 (GRCm39) probably benign Het
Dnah10 T C 5: 124,803,949 (GRCm39) V92A probably benign Het
Evl C T 12: 108,647,783 (GRCm39) R295* probably null Het
Fam184a A T 10: 53,514,355 (GRCm39) L1022Q probably damaging Het
Foxd4 T C 19: 24,877,594 (GRCm39) H202R probably damaging Het
Fry T C 5: 150,233,861 (GRCm39) V16A probably benign Het
Gstcd A T 3: 132,777,894 (GRCm39) F306I probably benign Het
H2bc13 A G 13: 21,899,977 (GRCm39) S113P possibly damaging Het
Hivep3 T C 4: 119,954,711 (GRCm39) V1009A possibly damaging Het
Hoxd12 G T 2: 74,506,269 (GRCm39) R227L probably damaging Het
Ifi208 T A 1: 173,506,556 (GRCm39) M113K possibly damaging Het
Ift70a1 A T 2: 75,810,802 (GRCm39) M427K probably damaging Het
Kcnh4 T G 11: 100,643,278 (GRCm39) T330P probably damaging Het
Kctd17 CAGCTGGAGGAGC CAGC 15: 78,321,113 (GRCm39) probably benign Het
Lin28a G A 4: 133,733,574 (GRCm39) P158S probably damaging Het
Muc16 C A 9: 18,557,060 (GRCm39) E3078* probably null Het
Naaladl1 A G 19: 6,156,274 (GRCm39) N120S probably damaging Het
Nol10 G A 12: 17,402,648 (GRCm39) R40H probably benign Het
Ntng1 G A 3: 110,042,802 (GRCm39) S8L probably benign Het
Or4a71 T G 2: 89,357,948 (GRCm39) I269L probably benign Het
Or4c107 T A 2: 88,789,177 (GRCm39) Y122* probably null Het
Pacsin1 T A 17: 27,927,613 (GRCm39) F319I unknown Het
Pla2g4d G A 2: 120,109,413 (GRCm39) T212I probably benign Het
Ppp4r1 T A 17: 66,140,093 (GRCm39) C664S possibly damaging Het
Prodh2 T C 7: 30,210,580 (GRCm39) I377T probably damaging Het
Prss57 A T 10: 79,619,230 (GRCm39) L243H probably benign Het
Pxdn C T 12: 30,056,601 (GRCm39) L1271F probably damaging Het
Ros1 G A 10: 52,030,926 (GRCm39) R581* probably null Het
Rps6kc1 C T 1: 190,531,321 (GRCm39) G894S probably benign Het
Sirt7 A G 11: 120,510,016 (GRCm39) S183P unknown Het
Slc12a4 G A 8: 106,678,237 (GRCm39) R319W possibly damaging Het
Son AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,457,222 (GRCm39) probably benign Het
Styxl2 T A 1: 165,926,708 (GRCm39) E968V probably damaging Het
Tbc1d8 A G 1: 39,431,250 (GRCm39) F374S probably damaging Het
Tdrd1 T A 19: 56,837,134 (GRCm39) D489E probably damaging Het
Tiprl T A 1: 165,064,543 (GRCm39) probably benign Het
Tpt1 T C 14: 76,085,539 (GRCm39) *173Q probably null Het
Trim17 A G 11: 58,859,394 (GRCm39) I203V probably benign Het
Trim43b T A 9: 88,973,361 (GRCm39) H124L probably damaging Het
Triobp T C 15: 78,852,186 (GRCm39) I780T probably damaging Het
Tyrobp G A 7: 30,114,063 (GRCm39) G101R Het
Vmn1r181 A T 7: 23,683,871 (GRCm39) H112L probably benign Het
Wdr19 A G 5: 65,381,193 (GRCm39) N406D probably damaging Het
Zc3h12a T C 4: 125,013,728 (GRCm39) K379E probably benign Het
Zcwpw1 T C 5: 137,799,323 (GRCm39) I230T probably benign Het
Zfhx4 A G 3: 5,477,533 (GRCm39) T3383A probably benign Het
Other mutations in Brdt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02342:Brdt APN 5 107,490,069 (GRCm39) missense probably damaging 1.00
IGL02718:Brdt APN 5 107,497,934 (GRCm39) splice site probably benign
IGL02746:Brdt APN 5 107,518,190 (GRCm39) missense probably benign
IGL02851:Brdt APN 5 107,525,861 (GRCm39) missense possibly damaging 0.47
R0585:Brdt UTSW 5 107,504,748 (GRCm39) critical splice donor site probably null
R0708:Brdt UTSW 5 107,506,766 (GRCm39) nonsense probably null
R1338:Brdt UTSW 5 107,498,054 (GRCm39) missense probably benign 0.02
R1710:Brdt UTSW 5 107,491,450 (GRCm39) missense probably damaging 1.00
R1794:Brdt UTSW 5 107,507,719 (GRCm39) small deletion probably benign
R1861:Brdt UTSW 5 107,507,324 (GRCm39) missense probably benign
R1913:Brdt UTSW 5 107,496,479 (GRCm39) missense probably benign
R2029:Brdt UTSW 5 107,507,090 (GRCm39) missense probably benign 0.35
R2431:Brdt UTSW 5 107,525,881 (GRCm39) splice site probably null
R3121:Brdt UTSW 5 107,525,011 (GRCm39) missense probably damaging 0.99
R3122:Brdt UTSW 5 107,525,011 (GRCm39) missense probably damaging 0.99
R4258:Brdt UTSW 5 107,507,775 (GRCm39) missense probably damaging 0.97
R4609:Brdt UTSW 5 107,507,802 (GRCm39) missense probably benign 0.00
R5306:Brdt UTSW 5 107,493,010 (GRCm39) missense probably damaging 1.00
R5640:Brdt UTSW 5 107,507,174 (GRCm39) nonsense probably null
R5677:Brdt UTSW 5 107,496,483 (GRCm39) missense possibly damaging 0.85
R5936:Brdt UTSW 5 107,507,261 (GRCm39) missense probably damaging 1.00
R6145:Brdt UTSW 5 107,525,865 (GRCm39) missense possibly damaging 0.67
R6261:Brdt UTSW 5 107,496,369 (GRCm39) missense probably benign 0.04
R6408:Brdt UTSW 5 107,533,358 (GRCm39) missense probably damaging 1.00
R6930:Brdt UTSW 5 107,507,081 (GRCm39) missense probably benign 0.35
R7372:Brdt UTSW 5 107,518,160 (GRCm39) missense possibly damaging 0.49
R7741:Brdt UTSW 5 107,506,752 (GRCm39) missense probably benign 0.00
R7842:Brdt UTSW 5 107,496,454 (GRCm39) missense possibly damaging 0.49
R7869:Brdt UTSW 5 107,518,045 (GRCm39) missense probably benign 0.04
R7887:Brdt UTSW 5 107,507,799 (GRCm39) missense possibly damaging 0.66
R8064:Brdt UTSW 5 107,525,862 (GRCm39) nonsense probably null
R8958:Brdt UTSW 5 107,525,877 (GRCm39) missense probably benign
R9199:Brdt UTSW 5 107,498,029 (GRCm39) nonsense probably null
R9346:Brdt UTSW 5 107,524,880 (GRCm39) missense probably damaging 0.99
X0011:Brdt UTSW 5 107,524,958 (GRCm39) missense probably damaging 1.00
X0011:Brdt UTSW 5 107,489,994 (GRCm39) missense probably damaging 0.96
Z1176:Brdt UTSW 5 107,507,764 (GRCm39) missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- TATGACTAAGTCGTCAGCAACAGTG -3'
(R):5'- GCATGGGCATGAATAGGCTTAC -3'

Sequencing Primer
(F):5'- ACTGGGGCTTATTTTTCCAACTG -3'
(R):5'- GGCATGAATAGGCTTACACACCTG -3'
Posted On 2020-09-15