Incidental Mutation 'R7972:Brdt'
ID650653
Institutional Source Beutler Lab
Gene Symbol Brdt
Ensembl Gene ENSMUSG00000029279
Gene Namebromodomain, testis-specific
SynonymsFsrg3, 7420412D09Rik, Brd6
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7972 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location107331159-107387058 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 107348549 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 176 (I176F)
Ref Sequence ENSEMBL: ENSMUSP00000031215 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031215] [ENSMUST00000112677]
PDB Structure Structure of Brdt bromodomain 2 bound to an acetylated histone H3 peptide [X-RAY DIFFRACTION]
Structure of Brdt bromodomain BD1 bound to a diacetylated histone H4 peptide. [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031215
AA Change: I176F

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000031215
Gene: ENSMUSG00000029279
AA Change: I176F

DomainStartEndE-ValueType
BROMO 24 134 2.7e-45 SMART
BROMO 268 377 2.18e-40 SMART
low complexity region 392 417 N/A INTRINSIC
low complexity region 446 455 N/A INTRINSIC
low complexity region 472 500 N/A INTRINSIC
Pfam:BET 505 569 9.2e-34 PFAM
low complexity region 585 603 N/A INTRINSIC
low complexity region 649 691 N/A INTRINSIC
low complexity region 895 909 N/A INTRINSIC
Pfam:BRD4_CDT 913 956 3e-26 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000112677
AA Change: I176F

PolyPhen 2 Score 0.851 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000108297
Gene: ENSMUSG00000029279
AA Change: I176F

DomainStartEndE-ValueType
BROMO 24 134 2.7e-45 SMART
Pfam:Bromodomain 275 326 2.7e-8 PFAM
Meta Mutation Damage Score 0.0935 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: The protein encoded by this gene belongs to the BET protein family. BET proteins have two N-terminal bromodomains and one C-terminal extraterminal domain (ET domain). BET proteins regulate chromatin reorganization via binding to acetylated histones. This gene is thought to play a role in the transcriptional regulation of spermatogenesis. Although referred to as testis-specific bromodomain (Brdt) protein, RT-PCR indicates that this gene is expressed in both mouse oocytes and testes. Alternative splicing results in multiple transcript variants encoding different proteins. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this genes leads to arrest of spermatogenesis and male infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd16a T A 17: 35,101,311 V384E probably damaging Het
Acacb C T 5: 114,226,857 R1533* probably null Het
Alox12 T A 11: 70,242,687 M604L probably benign Het
Amotl2 C T 9: 102,723,769 T345I probably benign Het
Cdk5 G T 5: 24,419,658 T245K probably benign Het
Chd9 A T 8: 91,005,767 R1304S unknown Het
Clpsl2 G A 17: 28,550,728 G55R probably damaging Het
Cyp2j11 T A 4: 96,297,634 E438V probably damaging Het
Dao AGG AG 5: 114,015,209 probably benign Het
Dnah10 T C 5: 124,726,885 V92A probably benign Het
Dusp27 T A 1: 166,099,139 E968V probably damaging Het
Evl C T 12: 108,681,524 R295* probably null Het
Fam184a A T 10: 53,638,259 L1022Q probably damaging Het
Foxd4 T C 19: 24,900,230 H202R probably damaging Het
Fry T C 5: 150,310,396 V16A probably benign Het
Gstcd A T 3: 133,072,133 F306I probably benign Het
Hist1h2bl A G 13: 21,715,807 S113P possibly damaging Het
Hivep3 T C 4: 120,097,514 V1009A possibly damaging Het
Hoxd12 G T 2: 74,675,925 R227L probably damaging Het
Ifi208 T A 1: 173,678,990 M113K possibly damaging Het
Kcnh4 T G 11: 100,752,452 T330P probably damaging Het
Kctd17 CAGCTGGAGGAGC CAGC 15: 78,436,913 probably benign Het
Lin28a G A 4: 134,006,263 P158S probably damaging Het
Muc16 C A 9: 18,645,764 E3078* probably null Het
Naaladl1 A G 19: 6,106,244 N120S probably damaging Het
Nol10 G A 12: 17,352,647 R40H probably benign Het
Ntng1 G A 3: 110,135,486 S8L probably benign Het
Olfr1212 T A 2: 88,958,833 Y122* probably null Het
Olfr1243 T G 2: 89,527,604 I269L probably benign Het
Pacsin1 T A 17: 27,708,639 F319I unknown Het
Pla2g4d G A 2: 120,278,932 T212I probably benign Het
Ppp4r1 T A 17: 65,833,098 C664S possibly damaging Het
Prodh2 T C 7: 30,511,155 I377T probably damaging Het
Prss57 A T 10: 79,783,396 L243H probably benign Het
Pxdn C T 12: 30,006,602 L1271F probably damaging Het
Ros1 G A 10: 52,154,830 R581* probably null Het
Rps6kc1 C T 1: 190,799,124 G894S probably benign Het
Sirt7 A G 11: 120,619,190 S183P unknown Het
Slc12a4 G A 8: 105,951,605 R319W possibly damaging Het
Son AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,334 probably benign Het
Tbc1d8 A G 1: 39,392,169 F374S probably damaging Het
Tdrd1 T A 19: 56,848,702 D489E probably damaging Het
Tiprl T A 1: 165,236,974 probably benign Het
Tpt1 T C 14: 75,848,099 *173Q probably null Het
Trim17 A G 11: 58,968,568 I203V probably benign Het
Trim43b T A 9: 89,091,308 H124L probably damaging Het
Triobp T C 15: 78,967,986 I780T probably damaging Het
Ttc30a1 A T 2: 75,980,458 M427K probably damaging Het
Tyrobp G A 7: 30,414,638 G101R Het
Vmn1r181 A T 7: 23,984,446 H112L probably benign Het
Wdr19 A G 5: 65,223,850 N406D probably damaging Het
Zc3h12a T C 4: 125,119,935 K379E probably benign Het
Zcwpw1 T C 5: 137,801,061 I230T probably benign Het
Zfhx4 A G 3: 5,412,473 T3383A probably benign Het
Other mutations in Brdt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02342:Brdt APN 5 107342203 missense probably damaging 1.00
IGL02718:Brdt APN 5 107350068 splice site probably benign
IGL02746:Brdt APN 5 107370324 missense probably benign
IGL02851:Brdt APN 5 107377995 missense possibly damaging 0.47
R0585:Brdt UTSW 5 107356882 critical splice donor site probably null
R0708:Brdt UTSW 5 107358900 nonsense probably null
R1338:Brdt UTSW 5 107350188 missense probably benign 0.02
R1710:Brdt UTSW 5 107343584 missense probably damaging 1.00
R1794:Brdt UTSW 5 107359853 small deletion probably benign
R1861:Brdt UTSW 5 107359458 missense probably benign
R1913:Brdt UTSW 5 107348613 missense probably benign
R2029:Brdt UTSW 5 107359224 missense probably benign 0.35
R2431:Brdt UTSW 5 107378015 splice site probably null
R3121:Brdt UTSW 5 107377145 missense probably damaging 0.99
R3122:Brdt UTSW 5 107377145 missense probably damaging 0.99
R4258:Brdt UTSW 5 107359909 missense probably damaging 0.97
R4609:Brdt UTSW 5 107359936 missense probably benign 0.00
R5306:Brdt UTSW 5 107345144 missense probably damaging 1.00
R5640:Brdt UTSW 5 107359308 nonsense probably null
R5677:Brdt UTSW 5 107348617 missense possibly damaging 0.85
R5936:Brdt UTSW 5 107359395 missense probably damaging 1.00
R6145:Brdt UTSW 5 107377999 missense possibly damaging 0.67
R6261:Brdt UTSW 5 107348503 missense probably benign 0.04
R6408:Brdt UTSW 5 107385492 missense probably damaging 1.00
R6930:Brdt UTSW 5 107359215 missense probably benign 0.35
R7372:Brdt UTSW 5 107370294 missense possibly damaging 0.49
R7741:Brdt UTSW 5 107358886 missense probably benign 0.00
R7842:Brdt UTSW 5 107348588 missense possibly damaging 0.49
R7869:Brdt UTSW 5 107370179 missense probably benign 0.04
R7887:Brdt UTSW 5 107359933 missense possibly damaging 0.66
R8064:Brdt UTSW 5 107377996 nonsense probably null
R8958:Brdt UTSW 5 107378011 missense probably benign
X0011:Brdt UTSW 5 107342128 missense probably damaging 0.96
X0011:Brdt UTSW 5 107377092 missense probably damaging 1.00
Z1176:Brdt UTSW 5 107359898 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- TATGACTAAGTCGTCAGCAACAGTG -3'
(R):5'- GCATGGGCATGAATAGGCTTAC -3'

Sequencing Primer
(F):5'- ACTGGGGCTTATTTTTCCAACTG -3'
(R):5'- GGCATGAATAGGCTTACACACCTG -3'
Posted On2020-09-15