Incidental Mutation 'R7972:Acacb'
ID650655
Institutional Source Beutler Lab
Gene Symbol Acacb
Ensembl Gene ENSMUSG00000042010
Gene Nameacetyl-Coenzyme A carboxylase beta
SynonymsAcc2, Accb
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7972 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location114146535-114250761 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 114226857 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 1533 (R1533*)
Ref Sequence ENSEMBL: ENSMUSP00000031583 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031583] [ENSMUST00000102582]
Predicted Effect probably null
Transcript: ENSMUST00000031583
AA Change: R1533*
SMART Domains Protein: ENSMUSP00000031583
Gene: ENSMUSG00000042010
AA Change: R1533*

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 38 60 N/A INTRINSIC
Pfam:CPSase_L_chain 249 369 2.1e-32 PFAM
Pfam:CPSase_L_D2 405 606 3.3e-52 PFAM
Pfam:ATP-grasp_4 413 576 2.1e-9 PFAM
Biotin_carb_C 640 747 9.54e-26 SMART
Pfam:Biotin_lipoyl 885 951 1.9e-17 PFAM
Pfam:ACC_central 952 1678 2.2e-290 PFAM
Pfam:Carboxyl_trans 1770 2324 2.3e-181 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000102582
AA Change: R1533*
SMART Domains Protein: ENSMUSP00000099642
Gene: ENSMUSG00000042010
AA Change: R1533*

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 38 60 N/A INTRINSIC
Pfam:CPSase_L_chain 249 369 8.2e-29 PFAM
Pfam:CPSase_L_D2 405 606 3.8e-52 PFAM
Pfam:ATP-grasp_4 409 576 1.4e-12 PFAM
Biotin_carb_C 640 747 9.54e-26 SMART
Pfam:Biotin_lipoyl 885 951 9.1e-17 PFAM
Pfam:ACC_central 952 1678 2.3e-250 PFAM
Pfam:Carboxyl_trans 1770 2324 4.8e-172 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Acetyl-CoA carboxylase (ACC) is a complex multifunctional enzyme system. ACC is a biotin-containing enzyme which catalyzes the carboxylation of acetyl-CoA to malonyl-CoA, the rate-limiting step in fatty acid synthesis. ACC-beta is thought to control fatty acid oxidation by means of the ability of malonyl-CoA to inhibit carnitine-palmitoyl-CoA transferase I, the rate-limiting step in fatty acid uptake and oxidation by mitochondria. ACC-beta may be involved in the regulation of fatty acid oxidation, rather than fatty acid biosynthesis. There is evidence for the presence of two ACC-beta isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable, fertile and overtly normal but exhibit high levels of fatty acid oxidation, as well as reduced fat accumulation in their adipose tissue and liver, and decreased storage of glycogen in their liver. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd16a T A 17: 35,101,311 V384E probably damaging Het
Alox12 T A 11: 70,242,687 M604L probably benign Het
Amotl2 C T 9: 102,723,769 T345I probably benign Het
Brdt A T 5: 107,348,549 I176F possibly damaging Het
Cdk5 G T 5: 24,419,658 T245K probably benign Het
Chd9 A T 8: 91,005,767 R1304S unknown Het
Clpsl2 G A 17: 28,550,728 G55R probably damaging Het
Cyp2j11 T A 4: 96,297,634 E438V probably damaging Het
Dao AGG AG 5: 114,015,209 probably benign Het
Dnah10 T C 5: 124,726,885 V92A probably benign Het
Dusp27 T A 1: 166,099,139 E968V probably damaging Het
Evl C T 12: 108,681,524 R295* probably null Het
Fam184a A T 10: 53,638,259 L1022Q probably damaging Het
Foxd4 T C 19: 24,900,230 H202R probably damaging Het
Fry T C 5: 150,310,396 V16A probably benign Het
Gstcd A T 3: 133,072,133 F306I probably benign Het
Hist1h2bl A G 13: 21,715,807 S113P possibly damaging Het
Hivep3 T C 4: 120,097,514 V1009A possibly damaging Het
Hoxd12 G T 2: 74,675,925 R227L probably damaging Het
Ifi208 T A 1: 173,678,990 M113K possibly damaging Het
Kcnh4 T G 11: 100,752,452 T330P probably damaging Het
Kctd17 CAGCTGGAGGAGC CAGC 15: 78,436,913 probably benign Het
Lin28a G A 4: 134,006,263 P158S probably damaging Het
Muc16 C A 9: 18,645,764 E3078* probably null Het
Naaladl1 A G 19: 6,106,244 N120S probably damaging Het
Nol10 G A 12: 17,352,647 R40H probably benign Het
Ntng1 G A 3: 110,135,486 S8L probably benign Het
Olfr1212 T A 2: 88,958,833 Y122* probably null Het
Olfr1243 T G 2: 89,527,604 I269L probably benign Het
Pacsin1 T A 17: 27,708,639 F319I unknown Het
Pla2g4d G A 2: 120,278,932 T212I probably benign Het
Ppp4r1 T A 17: 65,833,098 C664S possibly damaging Het
Prodh2 T C 7: 30,511,155 I377T probably damaging Het
Prss57 A T 10: 79,783,396 L243H probably benign Het
Pxdn C T 12: 30,006,602 L1271F probably damaging Het
Ros1 G A 10: 52,154,830 R581* probably null Het
Rps6kc1 C T 1: 190,799,124 G894S probably benign Het
Sirt7 A G 11: 120,619,190 S183P unknown Het
Slc12a4 G A 8: 105,951,605 R319W possibly damaging Het
Son AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,334 probably benign Het
Tbc1d8 A G 1: 39,392,169 F374S probably damaging Het
Tdrd1 T A 19: 56,848,702 D489E probably damaging Het
Tpt1 T C 14: 75,848,099 *173Q probably null Het
Trim17 A G 11: 58,968,568 I203V probably benign Het
Trim43b T A 9: 89,091,308 H124L probably damaging Het
Triobp T C 15: 78,967,986 I780T probably damaging Het
Ttc30a1 A T 2: 75,980,458 M427K probably damaging Het
Tyrobp G A 7: 30,414,638 G101R Het
Vmn1r181 A T 7: 23,984,446 H112L probably benign Het
Wdr19 A G 5: 65,223,850 N406D probably damaging Het
Zc3h12a T C 4: 125,119,935 K379E probably benign Het
Zcwpw1 T C 5: 137,801,061 I230T probably benign Het
Zfhx4 A G 3: 5,412,473 T3383A probably benign Het
Other mutations in Acacb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Acacb APN 5 114200289 missense probably damaging 1.00
IGL01291:Acacb APN 5 114225870 missense probably benign 0.03
IGL01301:Acacb APN 5 114246498 missense probably benign
IGL01633:Acacb APN 5 114218858 splice site probably benign
IGL01736:Acacb APN 5 114188442 missense possibly damaging 0.96
IGL01782:Acacb APN 5 114200520 missense probably damaging 1.00
IGL01924:Acacb APN 5 114223986 splice site probably benign
IGL01933:Acacb APN 5 114184190 splice site probably benign
IGL02028:Acacb APN 5 114166015 missense probably damaging 1.00
IGL02045:Acacb APN 5 114240660 missense possibly damaging 0.95
IGL02346:Acacb APN 5 114238699 missense probably damaging 1.00
IGL02421:Acacb APN 5 114223878 missense probably benign 0.00
IGL02445:Acacb APN 5 114245137 missense probably damaging 1.00
IGL02491:Acacb APN 5 114192105 missense probably damaging 1.00
IGL02598:Acacb APN 5 114246037 missense probably damaging 1.00
IGL02700:Acacb APN 5 114218881 missense probably damaging 1.00
IGL02730:Acacb APN 5 114166149 splice site probably benign
IGL03110:Acacb APN 5 114195234 missense probably damaging 0.96
IGL03125:Acacb APN 5 114204805 missense possibly damaging 0.49
IGL03263:Acacb APN 5 114213693 missense probably damaging 1.00
IGL03324:Acacb APN 5 114225854 nonsense probably null
ANU05:Acacb UTSW 5 114225870 missense probably benign 0.03
ANU18:Acacb UTSW 5 114246498 missense probably benign
BB001:Acacb UTSW 5 114245220 missense possibly damaging 0.63
BB011:Acacb UTSW 5 114245220 missense possibly damaging 0.63
I0000:Acacb UTSW 5 114238655 missense probably damaging 0.99
R0001:Acacb UTSW 5 114204833 splice site probably benign
R0219:Acacb UTSW 5 114232944 missense possibly damaging 0.79
R0234:Acacb UTSW 5 114209817 missense probably damaging 0.99
R0234:Acacb UTSW 5 114209817 missense probably damaging 0.99
R0278:Acacb UTSW 5 114233259 nonsense probably null
R0607:Acacb UTSW 5 114200301 missense probably damaging 1.00
R0964:Acacb UTSW 5 114229752 missense possibly damaging 0.64
R1116:Acacb UTSW 5 114210956 missense probably damaging 1.00
R1196:Acacb UTSW 5 114245092 missense probably benign 0.00
R1204:Acacb UTSW 5 114190153 missense probably damaging 1.00
R1387:Acacb UTSW 5 114200512 missense probably benign
R1415:Acacb UTSW 5 114165921 missense probably benign
R1475:Acacb UTSW 5 114195252 missense possibly damaging 0.87
R1497:Acacb UTSW 5 114196807 missense probably damaging 1.00
R1520:Acacb UTSW 5 114201940 missense possibly damaging 0.67
R1591:Acacb UTSW 5 114203423 missense possibly damaging 0.87
R1644:Acacb UTSW 5 114195285 missense probably damaging 1.00
R1732:Acacb UTSW 5 114190087 missense possibly damaging 0.63
R1783:Acacb UTSW 5 114209767 frame shift probably null
R1784:Acacb UTSW 5 114209767 frame shift probably null
R1834:Acacb UTSW 5 114235475 missense probably damaging 1.00
R1858:Acacb UTSW 5 114196709 missense probably benign 0.13
R1886:Acacb UTSW 5 114218959 missense probably damaging 1.00
R1901:Acacb UTSW 5 114165734 nonsense probably null
R1902:Acacb UTSW 5 114165734 nonsense probably null
R1903:Acacb UTSW 5 114165734 nonsense probably null
R1924:Acacb UTSW 5 114230720 missense possibly damaging 0.67
R1934:Acacb UTSW 5 114198282 missense probably benign 0.27
R2051:Acacb UTSW 5 114245890 missense probably damaging 1.00
R2132:Acacb UTSW 5 114209767 frame shift probably null
R2133:Acacb UTSW 5 114209767 frame shift probably null
R2260:Acacb UTSW 5 114216917 missense probably damaging 0.99
R2967:Acacb UTSW 5 114166070 missense possibly damaging 0.81
R3421:Acacb UTSW 5 114212636 splice site probably null
R3729:Acacb UTSW 5 114207348 missense probably damaging 0.99
R4206:Acacb UTSW 5 114213651 missense probably benign
R4245:Acacb UTSW 5 114230784 missense probably damaging 0.97
R4386:Acacb UTSW 5 114241921 critical splice acceptor site probably null
R4439:Acacb UTSW 5 114246496 missense possibly damaging 0.50
R4577:Acacb UTSW 5 114226831 missense probably damaging 1.00
R4658:Acacb UTSW 5 114200564 missense probably damaging 0.96
R4688:Acacb UTSW 5 114204763 missense probably benign 0.01
R4720:Acacb UTSW 5 114229914 missense possibly damaging 0.73
R4898:Acacb UTSW 5 114232938 missense probably benign 0.04
R5044:Acacb UTSW 5 114166027 missense probably benign 0.03
R5070:Acacb UTSW 5 114246028 missense possibly damaging 0.46
R5294:Acacb UTSW 5 114241952 missense probably damaging 1.00
R5350:Acacb UTSW 5 114244551 missense probably damaging 1.00
R5401:Acacb UTSW 5 114209853 missense possibly damaging 0.80
R5531:Acacb UTSW 5 114204706 missense possibly damaging 0.92
R5542:Acacb UTSW 5 114195737 missense probably damaging 1.00
R5751:Acacb UTSW 5 114230832 missense possibly damaging 0.79
R5821:Acacb UTSW 5 114184106 missense possibly damaging 0.69
R5893:Acacb UTSW 5 114229851 missense probably benign 0.01
R5911:Acacb UTSW 5 114232890 missense probably damaging 0.97
R5944:Acacb UTSW 5 114245980 missense probably damaging 1.00
R5973:Acacb UTSW 5 114226867 missense probably damaging 1.00
R6027:Acacb UTSW 5 114165600 missense probably benign 0.43
R6103:Acacb UTSW 5 114245881 missense probably damaging 1.00
R6139:Acacb UTSW 5 114212652 missense probably damaging 1.00
R6292:Acacb UTSW 5 114200251 missense probably damaging 1.00
R6368:Acacb UTSW 5 114216823 missense probably damaging 0.98
R6429:Acacb UTSW 5 114228591 missense probably damaging 1.00
R6942:Acacb UTSW 5 114191963 critical splice donor site probably null
R7138:Acacb UTSW 5 114207326 missense probably benign 0.12
R7241:Acacb UTSW 5 114245100 missense possibly damaging 0.94
R7254:Acacb UTSW 5 114209751 critical splice acceptor site probably null
R7396:Acacb UTSW 5 114213661 missense possibly damaging 0.87
R7439:Acacb UTSW 5 114195642 missense possibly damaging 0.84
R7484:Acacb UTSW 5 114218862 missense probably damaging 1.00
R7585:Acacb UTSW 5 114246012 missense probably damaging 0.99
R7712:Acacb UTSW 5 114165738 missense probably benign 0.13
R7868:Acacb UTSW 5 114248227 missense probably benign 0.22
R7873:Acacb UTSW 5 114223278 missense possibly damaging 0.88
R7924:Acacb UTSW 5 114245220 missense possibly damaging 0.63
R7940:Acacb UTSW 5 114166047 missense possibly damaging 0.77
R7951:Acacb UTSW 5 114188340 missense probably damaging 1.00
R7960:Acacb UTSW 5 114230861 missense probably benign 0.00
R8007:Acacb UTSW 5 114218874 missense probably damaging 0.97
R8022:Acacb UTSW 5 114223854 missense probably benign
R8030:Acacb UTSW 5 114233167 missense probably damaging 1.00
R8241:Acacb UTSW 5 114195236 missense possibly damaging 0.49
R8264:Acacb UTSW 5 114207366 missense probably benign 0.00
R8292:Acacb UTSW 5 114200494 critical splice acceptor site probably null
V1662:Acacb UTSW 5 114238708 missense probably damaging 1.00
Z1176:Acacb UTSW 5 114248948 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CACAGTGACAAATGGACTGTC -3'
(R):5'- ACCGCTAGCTGATGTGTCTG -3'

Sequencing Primer
(F):5'- AGTGACAAATGGACTGTCCTCTC -3'
(R):5'- TCTGCAAGGAGTCAGGATACCTC -3'
Posted On2020-09-15