Incidental Mutation 'R7972:Trim43b'
ID650665
Institutional Source Beutler Lab
Gene Symbol Trim43b
Ensembl Gene ENSMUSG00000079162
Gene Nametripartite motif-containing 43B
SynonymsGm8269
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R7972 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location89084624-89092835 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 89091308 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 124 (H124L)
Ref Sequence ENSEMBL: ENSMUSP00000126594 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167113] [ENSMUST00000189557]
Predicted Effect probably damaging
Transcript: ENSMUST00000167113
AA Change: H124L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126594
Gene: ENSMUSG00000079162
AA Change: H124L

DomainStartEndE-ValueType
RING 16 56 9.6e-7 SMART
Blast:BBOX 88 129 4e-8 BLAST
PDB:2VOK|B 329 445 3e-15 PDB
Blast:SPRY 336 441 9e-20 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000189557
AA Change: H124L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139457
Gene: ENSMUSG00000079162
AA Change: H124L

DomainStartEndE-ValueType
RING 16 56 4.7e-9 SMART
Blast:BBOX 88 129 4e-8 BLAST
SPRY 334 444 8.1e-5 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (48/49)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd16a T A 17: 35,101,311 V384E probably damaging Het
Acacb C T 5: 114,226,857 R1533* probably null Het
Alox12 T A 11: 70,242,687 M604L probably benign Het
Amotl2 C T 9: 102,723,769 T345I probably benign Het
Brdt A T 5: 107,348,549 I176F possibly damaging Het
Cdk5 G T 5: 24,419,658 T245K probably benign Het
Chd9 A T 8: 91,005,767 R1304S unknown Het
Clpsl2 G A 17: 28,550,728 G55R probably damaging Het
Cyp2j11 T A 4: 96,297,634 E438V probably damaging Het
Dao AGG AG 5: 114,015,209 probably benign Het
Dnah10 T C 5: 124,726,885 V92A probably benign Het
Dusp27 T A 1: 166,099,139 E968V probably damaging Het
Evl C T 12: 108,681,524 R295* probably null Het
Fam184a A T 10: 53,638,259 L1022Q probably damaging Het
Foxd4 T C 19: 24,900,230 H202R probably damaging Het
Fry T C 5: 150,310,396 V16A probably benign Het
Gstcd A T 3: 133,072,133 F306I probably benign Het
Hist1h2bl A G 13: 21,715,807 S113P possibly damaging Het
Hivep3 T C 4: 120,097,514 V1009A possibly damaging Het
Hoxd12 G T 2: 74,675,925 R227L probably damaging Het
Ifi208 T A 1: 173,678,990 M113K possibly damaging Het
Kcnh4 T G 11: 100,752,452 T330P probably damaging Het
Kctd17 CAGCTGGAGGAGC CAGC 15: 78,436,913 probably benign Het
Lin28a G A 4: 134,006,263 P158S probably damaging Het
Muc16 C A 9: 18,645,764 E3078* probably null Het
Naaladl1 A G 19: 6,106,244 N120S probably damaging Het
Nol10 G A 12: 17,352,647 R40H probably benign Het
Ntng1 G A 3: 110,135,486 S8L probably benign Het
Olfr1212 T A 2: 88,958,833 Y122* probably null Het
Olfr1243 T G 2: 89,527,604 I269L probably benign Het
Pacsin1 T A 17: 27,708,639 F319I unknown Het
Pla2g4d G A 2: 120,278,932 T212I probably benign Het
Ppp4r1 T A 17: 65,833,098 C664S possibly damaging Het
Prodh2 T C 7: 30,511,155 I377T probably damaging Het
Prss57 A T 10: 79,783,396 L243H probably benign Het
Pxdn C T 12: 30,006,602 L1271F probably damaging Het
Ros1 G A 10: 52,154,830 R581* probably null Het
Rps6kc1 C T 1: 190,799,124 G894S probably benign Het
Sirt7 A G 11: 120,619,190 S183P unknown Het
Slc12a4 G A 8: 105,951,605 R319W possibly damaging Het
Son AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,334 probably benign Het
Tbc1d8 A G 1: 39,392,169 F374S probably damaging Het
Tdrd1 T A 19: 56,848,702 D489E probably damaging Het
Tiprl T A 1: 165,236,974 probably benign Het
Tpt1 T C 14: 75,848,099 *173Q probably null Het
Trim17 A G 11: 58,968,568 I203V probably benign Het
Triobp T C 15: 78,967,986 I780T probably damaging Het
Ttc30a1 A T 2: 75,980,458 M427K probably damaging Het
Tyrobp G A 7: 30,414,638 G101R Het
Vmn1r181 A T 7: 23,984,446 H112L probably benign Het
Wdr19 A G 5: 65,223,850 N406D probably damaging Het
Zc3h12a T C 4: 125,119,935 K379E probably benign Het
Zcwpw1 T C 5: 137,801,061 I230T probably benign Het
Zfhx4 A G 3: 5,412,473 T3383A probably benign Het
Other mutations in Trim43b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Trim43b APN 9 89091642 missense probably benign 0.04
IGL01953:Trim43b APN 9 89085443 missense possibly damaging 0.74
IGL02160:Trim43b APN 9 89091630 missense probably benign 0.35
IGL02626:Trim43b APN 9 89085488 missense possibly damaging 0.89
IGL03199:Trim43b APN 9 89089428 missense probably damaging 0.98
R0477:Trim43b UTSW 9 89090601 missense probably damaging 1.00
R1345:Trim43b UTSW 9 89085672 missense possibly damaging 0.77
R1491:Trim43b UTSW 9 89087612 missense possibly damaging 0.52
R1536:Trim43b UTSW 9 89085358 nonsense probably null
R1862:Trim43b UTSW 9 89085571 missense probably damaging 1.00
R2211:Trim43b UTSW 9 89085249 missense possibly damaging 0.91
R4039:Trim43b UTSW 9 89091347 missense probably damaging 1.00
R4222:Trim43b UTSW 9 89090639 missense probably benign 0.00
R4223:Trim43b UTSW 9 89090639 missense probably benign 0.00
R4224:Trim43b UTSW 9 89090639 missense probably benign 0.00
R4726:Trim43b UTSW 9 89089485 missense possibly damaging 0.70
R4812:Trim43b UTSW 9 89091480 missense probably benign 0.05
R4887:Trim43b UTSW 9 89091312 missense probably damaging 0.99
R5865:Trim43b UTSW 9 89085606 missense probably benign 0.19
R5909:Trim43b UTSW 9 89085398 missense possibly damaging 0.94
R6226:Trim43b UTSW 9 89091275 missense possibly damaging 0.82
R6378:Trim43b UTSW 9 89085399 missense probably benign 0.08
R6531:Trim43b UTSW 9 89085365 missense probably damaging 1.00
R7114:Trim43b UTSW 9 89085608 missense probably benign 0.04
R7946:Trim43b UTSW 9 89091485 missense probably damaging 0.98
R8270:Trim43b UTSW 9 89085405 missense possibly damaging 0.77
R8887:Trim43b UTSW 9 89087589 missense probably benign 0.04
V5622:Trim43b UTSW 9 89092545 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TTAGTCTCATGTCACCAGCAC -3'
(R):5'- TTCTCTGAAGAAGCAGGTGTC -3'

Sequencing Primer
(F):5'- TGCATCGCTCAAGGATTATTTAC -3'
(R):5'- CTCTGAAGAAGCAGGTGTCCATTG -3'
Posted On2020-09-15