Incidental Mutation 'R7972:Alox12'
ID650671
Institutional Source Beutler Lab
Gene Symbol Alox12
Ensembl Gene ENSMUSG00000000320
Gene Namearachidonate 12-lipoxygenase
SynonymsP-12LO, 9930022G08Rik, Alox12p
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.151) question?
Stock #R7972 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location70241457-70255353 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 70242687 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 604 (M604L)
Ref Sequence ENSEMBL: ENSMUSP00000000329 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000329] [ENSMUST00000021180] [ENSMUST00000021181] [ENSMUST00000040428] [ENSMUST00000102569] [ENSMUST00000108575] [ENSMUST00000108576] [ENSMUST00000108577] [ENSMUST00000108578] [ENSMUST00000108579] [ENSMUST00000125752] [ENSMUST00000141880] [ENSMUST00000176116] [ENSMUST00000176268]
Predicted Effect probably benign
Transcript: ENSMUST00000000329
AA Change: M604L

PolyPhen 2 Score 0.148 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000000329
Gene: ENSMUSG00000000320
AA Change: M604L

DomainStartEndE-ValueType
LH2 2 111 9.78e-40 SMART
Pfam:Lipoxygenase 172 650 5.1e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000021180
SMART Domains Protein: ENSMUSP00000021180
Gene: ENSMUSG00000020831

DomainStartEndE-ValueType
Blast:SANT 38 69 1e-16 BLAST
SCOP:d1ba5__ 41 59 9e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000021181
SMART Domains Protein: ENSMUSP00000021181
Gene: ENSMUSG00000020831

DomainStartEndE-ValueType
SANT 38 83 7.29e-1 SMART
low complexity region 106 129 N/A INTRINSIC
low complexity region 135 150 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000040428
SMART Domains Protein: ENSMUSP00000048271
Gene: ENSMUSG00000093989

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 65 87 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102569
SMART Domains Protein: ENSMUSP00000099629
Gene: ENSMUSG00000020831

DomainStartEndE-ValueType
low complexity region 72 95 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108575
SMART Domains Protein: ENSMUSP00000104215
Gene: ENSMUSG00000020831

DomainStartEndE-ValueType
low complexity region 72 95 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108576
SMART Domains Protein: ENSMUSP00000104216
Gene: ENSMUSG00000020831

DomainStartEndE-ValueType
SANT 38 83 7.29e-1 SMART
low complexity region 106 129 N/A INTRINSIC
low complexity region 169 183 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108577
SMART Domains Protein: ENSMUSP00000104218
Gene: ENSMUSG00000020831

DomainStartEndE-ValueType
low complexity region 72 95 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108578
SMART Domains Protein: ENSMUSP00000104219
Gene: ENSMUSG00000020831

DomainStartEndE-ValueType
SANT 38 83 7.29e-1 SMART
low complexity region 106 129 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108579
SMART Domains Protein: ENSMUSP00000104220
Gene: ENSMUSG00000020831

DomainStartEndE-ValueType
low complexity region 72 95 N/A INTRINSIC
low complexity region 101 116 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125752
Predicted Effect probably benign
Transcript: ENSMUST00000141880
SMART Domains Protein: ENSMUSP00000135383
Gene: ENSMUSG00000093989

DomainStartEndE-ValueType
transmembrane domain 38 60 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176116
SMART Domains Protein: ENSMUSP00000135134
Gene: ENSMUSG00000040904

DomainStartEndE-ValueType
transmembrane domain 38 60 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176268
SMART Domains Protein: ENSMUSP00000135088
Gene: ENSMUSG00000040904

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 65 87 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (48/49)
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation exhibit increased basal transepidermal water loss and hypersensitivity to adenosine 5'-diphosphate-induced platelet aggregation and mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd16a T A 17: 35,101,311 V384E probably damaging Het
Acacb C T 5: 114,226,857 R1533* probably null Het
Amotl2 C T 9: 102,723,769 T345I probably benign Het
Brdt A T 5: 107,348,549 I176F possibly damaging Het
Cdk5 G T 5: 24,419,658 T245K probably benign Het
Chd9 A T 8: 91,005,767 R1304S unknown Het
Clpsl2 G A 17: 28,550,728 G55R probably damaging Het
Cyp2j11 T A 4: 96,297,634 E438V probably damaging Het
Dao AGG AG 5: 114,015,209 probably benign Het
Dnah10 T C 5: 124,726,885 V92A probably benign Het
Dusp27 T A 1: 166,099,139 E968V probably damaging Het
Evl C T 12: 108,681,524 R295* probably null Het
Fam184a A T 10: 53,638,259 L1022Q probably damaging Het
Foxd4 T C 19: 24,900,230 H202R probably damaging Het
Fry T C 5: 150,310,396 V16A probably benign Het
Gstcd A T 3: 133,072,133 F306I probably benign Het
Hist1h2bl A G 13: 21,715,807 S113P possibly damaging Het
Hivep3 T C 4: 120,097,514 V1009A possibly damaging Het
Hoxd12 G T 2: 74,675,925 R227L probably damaging Het
Ifi208 T A 1: 173,678,990 M113K possibly damaging Het
Kcnh4 T G 11: 100,752,452 T330P probably damaging Het
Kctd17 CAGCTGGAGGAGC CAGC 15: 78,436,913 probably benign Het
Lin28a G A 4: 134,006,263 P158S probably damaging Het
Muc16 C A 9: 18,645,764 E3078* probably null Het
Naaladl1 A G 19: 6,106,244 N120S probably damaging Het
Nol10 G A 12: 17,352,647 R40H probably benign Het
Ntng1 G A 3: 110,135,486 S8L probably benign Het
Olfr1212 T A 2: 88,958,833 Y122* probably null Het
Olfr1243 T G 2: 89,527,604 I269L probably benign Het
Pacsin1 T A 17: 27,708,639 F319I unknown Het
Pla2g4d G A 2: 120,278,932 T212I probably benign Het
Ppp4r1 T A 17: 65,833,098 C664S possibly damaging Het
Prodh2 T C 7: 30,511,155 I377T probably damaging Het
Prss57 A T 10: 79,783,396 L243H probably benign Het
Pxdn C T 12: 30,006,602 L1271F probably damaging Het
Ros1 G A 10: 52,154,830 R581* probably null Het
Rps6kc1 C T 1: 190,799,124 G894S probably benign Het
Sirt7 A G 11: 120,619,190 S183P unknown Het
Slc12a4 G A 8: 105,951,605 R319W possibly damaging Het
Son AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,334 probably benign Het
Tbc1d8 A G 1: 39,392,169 F374S probably damaging Het
Tdrd1 T A 19: 56,848,702 D489E probably damaging Het
Tiprl T A 1: 165,236,974 probably benign Het
Tpt1 T C 14: 75,848,099 *173Q probably null Het
Trim17 A G 11: 58,968,568 I203V probably benign Het
Trim43b T A 9: 89,091,308 H124L probably damaging Het
Triobp T C 15: 78,967,986 I780T probably damaging Het
Ttc30a1 A T 2: 75,980,458 M427K probably damaging Het
Tyrobp G A 7: 30,414,638 G101R Het
Vmn1r181 A T 7: 23,984,446 H112L probably benign Het
Wdr19 A G 5: 65,223,850 N406D probably damaging Het
Zc3h12a T C 4: 125,119,935 K379E probably benign Het
Zcwpw1 T C 5: 137,801,061 I230T probably benign Het
Zfhx4 A G 3: 5,412,473 T3383A probably benign Het
Other mutations in Alox12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:Alox12 APN 11 70254549 missense probably benign 0.12
IGL01629:Alox12 APN 11 70242834 missense probably damaging 1.00
IGL02657:Alox12 APN 11 70247278 missense probably benign
IGL02966:Alox12 APN 11 70250085 missense probably damaging 1.00
R0243:Alox12 UTSW 11 70242716 missense possibly damaging 0.82
R0357:Alox12 UTSW 11 70242536 missense probably damaging 1.00
R0394:Alox12 UTSW 11 70245935 missense probably damaging 1.00
R0422:Alox12 UTSW 11 70254558 missense probably damaging 1.00
R0564:Alox12 UTSW 11 70252836 missense probably damaging 0.99
R0751:Alox12 UTSW 11 70246950 missense probably benign 0.00
R1539:Alox12 UTSW 11 70253243 splice site probably null
R1562:Alox12 UTSW 11 70250165 missense probably damaging 0.97
R2165:Alox12 UTSW 11 70242572 splice site probably null
R2295:Alox12 UTSW 11 70242465 missense probably benign 0.45
R4073:Alox12 UTSW 11 70247310 missense probably damaging 1.00
R4558:Alox12 UTSW 11 70253063 missense probably benign 0.03
R5081:Alox12 UTSW 11 70255314 splice site probably null
R5198:Alox12 UTSW 11 70254417 missense probably damaging 1.00
R5507:Alox12 UTSW 11 70254412 missense possibly damaging 0.87
R5793:Alox12 UTSW 11 70243053 missense probably benign 0.00
R5832:Alox12 UTSW 11 70253280 missense probably damaging 0.98
R5975:Alox12 UTSW 11 70242783 missense possibly damaging 0.89
R5984:Alox12 UTSW 11 70247055 missense possibly damaging 0.83
R5988:Alox12 UTSW 11 70251587 missense probably benign 0.05
R6030:Alox12 UTSW 11 70254591 missense possibly damaging 0.72
R6030:Alox12 UTSW 11 70254591 missense possibly damaging 0.72
R6248:Alox12 UTSW 11 70253110 missense probably damaging 1.00
R6505:Alox12 UTSW 11 70250204 missense probably damaging 1.00
R7320:Alox12 UTSW 11 70254472 missense probably benign 0.02
R7595:Alox12 UTSW 11 70242404 missense probably damaging 1.00
R8787:Alox12 UTSW 11 70253320 missense probably benign 0.01
R8845:Alox12 UTSW 11 70247051 missense probably damaging 1.00
X0025:Alox12 UTSW 11 70255224 missense probably damaging 0.96
Z1177:Alox12 UTSW 11 70251479 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- TGCTTGAAATTGGCTGAGCAC -3'
(R):5'- TCCTAACACTTGGGTTCTAAAGC -3'

Sequencing Primer
(F):5'- TGAGCACAGCTTTGGTCC -3'
(R):5'- GGGTTCTAAAGCCTCCATTTCC -3'
Posted On2020-09-15