Incidental Mutation 'R7972:Nol10'
ID650674
Institutional Source Beutler Lab
Gene Symbol Nol10
Ensembl Gene ENSMUSG00000061458
Gene Namenucleolar protein 10
SynonymsLOC217431
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.965) question?
Stock #R7972 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location17348458-17430095 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 17352647 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 40 (R40H)
Ref Sequence ENSEMBL: ENSMUSP00000035930 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046011]
Predicted Effect probably benign
Transcript: ENSMUST00000046011
AA Change: R40H

PolyPhen 2 Score 0.154 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000035930
Gene: ENSMUSG00000061458
AA Change: R40H

DomainStartEndE-ValueType
WD40 42 81 1.1e1 SMART
Blast:WD40 84 123 1e-8 BLAST
WD40 165 204 3.3e1 SMART
WD40 223 257 4.42e1 SMART
WD40 260 299 1.19e1 SMART
WD40 302 340 1.97e2 SMART
low complexity region 451 476 N/A INTRINSIC
Pfam:NUC153 482 509 1.4e-15 PFAM
low complexity region 515 536 N/A INTRINSIC
low complexity region 542 553 N/A INTRINSIC
coiled coil region 557 588 N/A INTRINSIC
low complexity region 650 660 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd16a T A 17: 35,101,311 V384E probably damaging Het
Acacb C T 5: 114,226,857 R1533* probably null Het
Alox12 T A 11: 70,242,687 M604L probably benign Het
Amotl2 C T 9: 102,723,769 T345I probably benign Het
Brdt A T 5: 107,348,549 I176F possibly damaging Het
Cdk5 G T 5: 24,419,658 T245K probably benign Het
Chd9 A T 8: 91,005,767 R1304S unknown Het
Clpsl2 G A 17: 28,550,728 G55R probably damaging Het
Cyp2j11 T A 4: 96,297,634 E438V probably damaging Het
Dao AGG AG 5: 114,015,209 probably benign Het
Dnah10 T C 5: 124,726,885 V92A probably benign Het
Dusp27 T A 1: 166,099,139 E968V probably damaging Het
Evl C T 12: 108,681,524 R295* probably null Het
Fam184a A T 10: 53,638,259 L1022Q probably damaging Het
Foxd4 T C 19: 24,900,230 H202R probably damaging Het
Fry T C 5: 150,310,396 V16A probably benign Het
Gstcd A T 3: 133,072,133 F306I probably benign Het
Hist1h2bl A G 13: 21,715,807 S113P possibly damaging Het
Hivep3 T C 4: 120,097,514 V1009A possibly damaging Het
Hoxd12 G T 2: 74,675,925 R227L probably damaging Het
Ifi208 T A 1: 173,678,990 M113K possibly damaging Het
Kcnh4 T G 11: 100,752,452 T330P probably damaging Het
Kctd17 CAGCTGGAGGAGC CAGC 15: 78,436,913 probably benign Het
Lin28a G A 4: 134,006,263 P158S probably damaging Het
Muc16 C A 9: 18,645,764 E3078* probably null Het
Naaladl1 A G 19: 6,106,244 N120S probably damaging Het
Ntng1 G A 3: 110,135,486 S8L probably benign Het
Olfr1212 T A 2: 88,958,833 Y122* probably null Het
Olfr1243 T G 2: 89,527,604 I269L probably benign Het
Pacsin1 T A 17: 27,708,639 F319I unknown Het
Pla2g4d G A 2: 120,278,932 T212I probably benign Het
Ppp4r1 T A 17: 65,833,098 C664S possibly damaging Het
Prodh2 T C 7: 30,511,155 I377T probably damaging Het
Prss57 A T 10: 79,783,396 L243H probably benign Het
Pxdn C T 12: 30,006,602 L1271F probably damaging Het
Ros1 G A 10: 52,154,830 R581* probably null Het
Rps6kc1 C T 1: 190,799,124 G894S probably benign Het
Sirt7 A G 11: 120,619,190 S183P unknown Het
Slc12a4 G A 8: 105,951,605 R319W possibly damaging Het
Son AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,334 probably benign Het
Tbc1d8 A G 1: 39,392,169 F374S probably damaging Het
Tdrd1 T A 19: 56,848,702 D489E probably damaging Het
Tpt1 T C 14: 75,848,099 *173Q probably null Het
Trim17 A G 11: 58,968,568 I203V probably benign Het
Trim43b T A 9: 89,091,308 H124L probably damaging Het
Triobp T C 15: 78,967,986 I780T probably damaging Het
Ttc30a1 A T 2: 75,980,458 M427K probably damaging Het
Tyrobp G A 7: 30,414,638 G101R Het
Vmn1r181 A T 7: 23,984,446 H112L probably benign Het
Wdr19 A G 5: 65,223,850 N406D probably damaging Het
Zc3h12a T C 4: 125,119,935 K379E probably benign Het
Zcwpw1 T C 5: 137,801,061 I230T probably benign Het
Zfhx4 A G 3: 5,412,473 T3383A probably benign Het
Other mutations in Nol10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00916:Nol10 APN 12 17361129 splice site probably benign
R1769:Nol10 UTSW 12 17416708 splice site probably benign
R1884:Nol10 UTSW 12 17368389 critical splice donor site probably null
R1930:Nol10 UTSW 12 17348554 start codon destroyed probably null 0.99
R1931:Nol10 UTSW 12 17348554 start codon destroyed probably null 0.99
R2010:Nol10 UTSW 12 17416101 missense probably benign 0.00
R2037:Nol10 UTSW 12 17361151 missense probably benign 0.01
R2168:Nol10 UTSW 12 17373584 missense probably damaging 1.00
R3729:Nol10 UTSW 12 17424673 missense probably benign 0.42
R3731:Nol10 UTSW 12 17424673 missense probably benign 0.42
R4368:Nol10 UTSW 12 17379292 missense probably damaging 1.00
R4618:Nol10 UTSW 12 17348561 missense probably damaging 0.98
R4736:Nol10 UTSW 12 17355287 missense probably damaging 1.00
R5342:Nol10 UTSW 12 17369620 splice site probably null
R5451:Nol10 UTSW 12 17359102 nonsense probably null
R5536:Nol10 UTSW 12 17416137 nonsense probably null
R5586:Nol10 UTSW 12 17416828 missense possibly damaging 0.73
R6045:Nol10 UTSW 12 17348478 start gained probably benign
R6833:Nol10 UTSW 12 17352727 missense probably benign 0.03
R7039:Nol10 UTSW 12 17429184 missense possibly damaging 0.94
R7189:Nol10 UTSW 12 17373561 critical splice acceptor site probably null
R7251:Nol10 UTSW 12 17402107 missense probably damaging 1.00
R7399:Nol10 UTSW 12 17402173 missense probably damaging 1.00
R7600:Nol10 UTSW 12 17369480 missense probably damaging 0.99
R7650:Nol10 UTSW 12 17362682 critical splice donor site probably null
R7729:Nol10 UTSW 12 17424675 missense possibly damaging 0.62
R7772:Nol10 UTSW 12 17348585 missense probably damaging 1.00
R7869:Nol10 UTSW 12 17358238 missense probably null 0.93
Z1177:Nol10 UTSW 12 17359088 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TGGACTTTTCAGTTAAAGAACATGTTC -3'
(R):5'- GTGACCTACTCCGAAAACTCATTTT -3'

Sequencing Primer
(F):5'- ATCCAAACTGTTGCCTGGTAG -3'
(R):5'- TCAGTGCAGAATCTAGGTCAC -3'
Posted On2020-09-15