Incidental Mutation 'R7972:Evl'
ID650676
Institutional Source Beutler Lab
Gene Symbol Evl
Ensembl Gene ENSMUSG00000021262
Gene NameEna-vasodilator stimulated phosphoprotein
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7972 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location108554720-108688516 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 108681524 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 295 (R295*)
Ref Sequence ENSEMBL: ENSMUSP00000152364 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021689] [ENSMUST00000077735] [ENSMUST00000109854] [ENSMUST00000172409] [ENSMUST00000223109]
Predicted Effect probably null
Transcript: ENSMUST00000021689
AA Change: R308*
SMART Domains Protein: ENSMUSP00000021689
Gene: ENSMUSG00000021262
AA Change: R308*

DomainStartEndE-ValueType
WH1 1 109 7.72e-53 SMART
low complexity region 172 204 N/A INTRINSIC
low complexity region 216 228 N/A INTRINSIC
low complexity region 240 251 N/A INTRINSIC
Pfam:VASP_tetra 375 411 2.6e-21 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000077735
AA Change: R308*
SMART Domains Protein: ENSMUSP00000076916
Gene: ENSMUSG00000021262
AA Change: R308*

DomainStartEndE-ValueType
WH1 1 109 7.72e-53 SMART
low complexity region 172 204 N/A INTRINSIC
low complexity region 216 228 N/A INTRINSIC
low complexity region 240 251 N/A INTRINSIC
Pfam:VASP_tetra 353 392 2e-26 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000109854
AA Change: R314*
SMART Domains Protein: ENSMUSP00000105480
Gene: ENSMUSG00000021262
AA Change: R314*

DomainStartEndE-ValueType
WH1 7 115 1.87e-51 SMART
low complexity region 178 210 N/A INTRINSIC
low complexity region 222 234 N/A INTRINSIC
low complexity region 246 257 N/A INTRINSIC
Pfam:VASP_tetra 359 398 7.1e-27 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000172409
AA Change: R295*
SMART Domains Protein: ENSMUSP00000133072
Gene: ENSMUSG00000021262
AA Change: R295*

DomainStartEndE-ValueType
WH1 1 96 5.82e-39 SMART
low complexity region 159 191 N/A INTRINSIC
low complexity region 203 215 N/A INTRINSIC
low complexity region 227 238 N/A INTRINSIC
Pfam:VASP_tetra 361 400 1.6e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000222255
Predicted Effect probably null
Transcript: ENSMUST00000223109
AA Change: R295*
Predicted Effect probably benign
Transcript: ENSMUST00000223548
Meta Mutation Damage Score 0.9757 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (48/49)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are viable with no apparent defects in gross morphology or histology. Mice homozygous for a different knock-out allele are viable and fertile but display defects in monocyte migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd16a T A 17: 35,101,311 V384E probably damaging Het
Acacb C T 5: 114,226,857 R1533* probably null Het
Alox12 T A 11: 70,242,687 M604L probably benign Het
Amotl2 C T 9: 102,723,769 T345I probably benign Het
Brdt A T 5: 107,348,549 I176F possibly damaging Het
Cdk5 G T 5: 24,419,658 T245K probably benign Het
Chd9 A T 8: 91,005,767 R1304S unknown Het
Clpsl2 G A 17: 28,550,728 G55R probably damaging Het
Cyp2j11 T A 4: 96,297,634 E438V probably damaging Het
Dao AGG AG 5: 114,015,209 probably benign Het
Dnah10 T C 5: 124,726,885 V92A probably benign Het
Dusp27 T A 1: 166,099,139 E968V probably damaging Het
Fam184a A T 10: 53,638,259 L1022Q probably damaging Het
Foxd4 T C 19: 24,900,230 H202R probably damaging Het
Fry T C 5: 150,310,396 V16A probably benign Het
Gstcd A T 3: 133,072,133 F306I probably benign Het
Hist1h2bl A G 13: 21,715,807 S113P possibly damaging Het
Hivep3 T C 4: 120,097,514 V1009A possibly damaging Het
Hoxd12 G T 2: 74,675,925 R227L probably damaging Het
Ifi208 T A 1: 173,678,990 M113K possibly damaging Het
Kcnh4 T G 11: 100,752,452 T330P probably damaging Het
Kctd17 CAGCTGGAGGAGC CAGC 15: 78,436,913 probably benign Het
Lin28a G A 4: 134,006,263 P158S probably damaging Het
Muc16 C A 9: 18,645,764 E3078* probably null Het
Naaladl1 A G 19: 6,106,244 N120S probably damaging Het
Nol10 G A 12: 17,352,647 R40H probably benign Het
Ntng1 G A 3: 110,135,486 S8L probably benign Het
Olfr1212 T A 2: 88,958,833 Y122* probably null Het
Olfr1243 T G 2: 89,527,604 I269L probably benign Het
Pacsin1 T A 17: 27,708,639 F319I unknown Het
Pla2g4d G A 2: 120,278,932 T212I probably benign Het
Ppp4r1 T A 17: 65,833,098 C664S possibly damaging Het
Prodh2 T C 7: 30,511,155 I377T probably damaging Het
Prss57 A T 10: 79,783,396 L243H probably benign Het
Pxdn C T 12: 30,006,602 L1271F probably damaging Het
Ros1 G A 10: 52,154,830 R581* probably null Het
Rps6kc1 C T 1: 190,799,124 G894S probably benign Het
Sirt7 A G 11: 120,619,190 S183P unknown Het
Slc12a4 G A 8: 105,951,605 R319W possibly damaging Het
Son AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,334 probably benign Het
Tbc1d8 A G 1: 39,392,169 F374S probably damaging Het
Tdrd1 T A 19: 56,848,702 D489E probably damaging Het
Tiprl T A 1: 165,236,974 probably benign Het
Tpt1 T C 14: 75,848,099 *173Q probably null Het
Trim17 A G 11: 58,968,568 I203V probably benign Het
Trim43b T A 9: 89,091,308 H124L probably damaging Het
Triobp T C 15: 78,967,986 I780T probably damaging Het
Ttc30a1 A T 2: 75,980,458 M427K probably damaging Het
Tyrobp G A 7: 30,414,638 G101R Het
Vmn1r181 A T 7: 23,984,446 H112L probably benign Het
Wdr19 A G 5: 65,223,850 N406D probably damaging Het
Zc3h12a T C 4: 125,119,935 K379E probably benign Het
Zcwpw1 T C 5: 137,801,061 I230T probably benign Het
Zfhx4 A G 3: 5,412,473 T3383A probably benign Het
Other mutations in Evl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02546:Evl APN 12 108648419 missense possibly damaging 0.47
IGL03391:Evl APN 12 108676099 splice site probably null
Husk UTSW 12 108648460 missense probably damaging 1.00
Pencil UTSW 12 108681524 nonsense probably null
Shaving UTSW 12 108648308 splice site probably benign
R0366:Evl UTSW 12 108686048 critical splice acceptor site probably null
R0603:Evl UTSW 12 108648422 missense probably damaging 1.00
R1843:Evl UTSW 12 108652996 missense probably damaging 1.00
R3431:Evl UTSW 12 108648308 splice site probably benign
R3432:Evl UTSW 12 108648308 splice site probably benign
R4915:Evl UTSW 12 108686106 missense probably damaging 1.00
R5137:Evl UTSW 12 108681522 missense probably benign 0.00
R5688:Evl UTSW 12 108673353 critical splice donor site probably null
R5933:Evl UTSW 12 108683257 missense possibly damaging 0.60
R5950:Evl UTSW 12 108675553 missense probably benign 0.16
R6144:Evl UTSW 12 108653031 missense probably damaging 1.00
R7235:Evl UTSW 12 108648460 missense probably damaging 1.00
R7369:Evl UTSW 12 108686565 missense unknown
R7639:Evl UTSW 12 108686103 missense probably damaging 1.00
R7822:Evl UTSW 12 108648464 missense probably damaging 1.00
R7967:Evl UTSW 12 108681524 nonsense probably null
R7968:Evl UTSW 12 108681524 nonsense probably null
R7970:Evl UTSW 12 108681524 nonsense probably null
R7973:Evl UTSW 12 108681524 nonsense probably null
R8017:Evl UTSW 12 108681524 nonsense probably null
R8019:Evl UTSW 12 108681524 nonsense probably null
R8020:Evl UTSW 12 108681524 nonsense probably null
R8046:Evl UTSW 12 108681524 nonsense probably null
R8105:Evl UTSW 12 108681524 nonsense probably null
R8122:Evl UTSW 12 108681524 nonsense probably null
R8123:Evl UTSW 12 108681524 nonsense probably null
R8124:Evl UTSW 12 108681524 nonsense probably null
R8125:Evl UTSW 12 108681524 nonsense probably null
R8126:Evl UTSW 12 108681524 nonsense probably null
R8298:Evl UTSW 12 108652973 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- TCTCCAGCCTAGTGATGTAAGG -3'
(R):5'- TAGCTGGACCAGATCAAGGG -3'

Sequencing Primer
(F):5'- AAGGATTGTGCTCTTGACTGAGAGAC -3'
(R):5'- ACACCTGCCTAGCTGTCTG -3'
Posted On2020-09-15