Incidental Mutation 'R7972:Hist1h2bl'
ID650677
Institutional Source Beutler Lab
Gene Symbol Hist1h2bl
Ensembl Gene ENSMUSG00000094338
Gene Namehistone cluster 1, H2bl
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Not available question?
Stock #R7972 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location21715763-21716143 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 21715807 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 113 (S113P)
Ref Sequence ENSEMBL: ENSMUSP00000089350 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070124] [ENSMUST00000091756] [ENSMUST00000188775]
Predicted Effect probably benign
Transcript: ENSMUST00000070124
SMART Domains Protein: ENSMUSP00000088285
Gene: ENSMUSG00000071516

DomainStartEndE-ValueType
H2A 3 123 8.07e-81 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000091756
AA Change: S113P

PolyPhen 2 Score 0.599 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000089350
Gene: ENSMUSG00000094338
AA Change: S113P

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
H2B 28 124 4.64e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188775
SMART Domains Protein: ENSMUSP00000140394
Gene: ENSMUSG00000101355

DomainStartEndE-ValueType
H3 34 136 1.5e-75 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene is intronless and encodes a replication-dependent histone that is a member of the histone H2B family. Transcripts from this gene lack polyA tails but instead contain a palindromic termination element. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd16a T A 17: 35,101,311 V384E probably damaging Het
Acacb C T 5: 114,226,857 R1533* probably null Het
Alox12 T A 11: 70,242,687 M604L probably benign Het
Amotl2 C T 9: 102,723,769 T345I probably benign Het
Brdt A T 5: 107,348,549 I176F possibly damaging Het
Cdk5 G T 5: 24,419,658 T245K probably benign Het
Chd9 A T 8: 91,005,767 R1304S unknown Het
Clpsl2 G A 17: 28,550,728 G55R probably damaging Het
Cyp2j11 T A 4: 96,297,634 E438V probably damaging Het
Dao AGG AG 5: 114,015,209 probably benign Het
Dnah10 T C 5: 124,726,885 V92A probably benign Het
Dusp27 T A 1: 166,099,139 E968V probably damaging Het
Evl C T 12: 108,681,524 R295* probably null Het
Fam184a A T 10: 53,638,259 L1022Q probably damaging Het
Foxd4 T C 19: 24,900,230 H202R probably damaging Het
Fry T C 5: 150,310,396 V16A probably benign Het
Gstcd A T 3: 133,072,133 F306I probably benign Het
Hivep3 T C 4: 120,097,514 V1009A possibly damaging Het
Hoxd12 G T 2: 74,675,925 R227L probably damaging Het
Ifi208 T A 1: 173,678,990 M113K possibly damaging Het
Kcnh4 T G 11: 100,752,452 T330P probably damaging Het
Kctd17 CAGCTGGAGGAGC CAGC 15: 78,436,913 probably benign Het
Lin28a G A 4: 134,006,263 P158S probably damaging Het
Muc16 C A 9: 18,645,764 E3078* probably null Het
Naaladl1 A G 19: 6,106,244 N120S probably damaging Het
Nol10 G A 12: 17,352,647 R40H probably benign Het
Ntng1 G A 3: 110,135,486 S8L probably benign Het
Olfr1212 T A 2: 88,958,833 Y122* probably null Het
Olfr1243 T G 2: 89,527,604 I269L probably benign Het
Pacsin1 T A 17: 27,708,639 F319I unknown Het
Pla2g4d G A 2: 120,278,932 T212I probably benign Het
Ppp4r1 T A 17: 65,833,098 C664S possibly damaging Het
Prodh2 T C 7: 30,511,155 I377T probably damaging Het
Prss57 A T 10: 79,783,396 L243H probably benign Het
Pxdn C T 12: 30,006,602 L1271F probably damaging Het
Ros1 G A 10: 52,154,830 R581* probably null Het
Rps6kc1 C T 1: 190,799,124 G894S probably benign Het
Sirt7 A G 11: 120,619,190 S183P unknown Het
Slc12a4 G A 8: 105,951,605 R319W possibly damaging Het
Son AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,334 probably benign Het
Tbc1d8 A G 1: 39,392,169 F374S probably damaging Het
Tdrd1 T A 19: 56,848,702 D489E probably damaging Het
Tiprl T A 1: 165,236,974 probably benign Het
Tpt1 T C 14: 75,848,099 *173Q probably null Het
Trim17 A G 11: 58,968,568 I203V probably benign Het
Trim43b T A 9: 89,091,308 H124L probably damaging Het
Triobp T C 15: 78,967,986 I780T probably damaging Het
Ttc30a1 A T 2: 75,980,458 M427K probably damaging Het
Tyrobp G A 7: 30,414,638 G101R Het
Vmn1r181 A T 7: 23,984,446 H112L probably benign Het
Wdr19 A G 5: 65,223,850 N406D probably damaging Het
Zc3h12a T C 4: 125,119,935 K379E probably benign Het
Zcwpw1 T C 5: 137,801,061 I230T probably benign Het
Zfhx4 A G 3: 5,412,473 T3383A probably benign Het
Other mutations in Hist1h2bl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01347:Hist1h2bl APN 13 21715894 missense probably damaging 1.00
R0482:Hist1h2bl UTSW 13 21716125 unclassified probably benign
R1341:Hist1h2bl UTSW 13 21716110 missense probably benign 0.09
R1355:Hist1h2bl UTSW 13 21715857 missense probably damaging 1.00
R4793:Hist1h2bl UTSW 13 21715918 missense probably benign 0.00
R4816:Hist1h2bl UTSW 13 21715965 missense probably benign 0.32
R4842:Hist1h2bl UTSW 13 21716064 unclassified probably benign
R4917:Hist1h2bl UTSW 13 21716019 missense probably damaging 0.97
R5355:Hist1h2bl UTSW 13 21715860 missense probably damaging 1.00
R6036:Hist1h2bl UTSW 13 21715978 missense probably damaging 0.99
R6036:Hist1h2bl UTSW 13 21715978 missense probably damaging 0.99
R7546:Hist1h2bl UTSW 13 21715870 missense probably benign 0.19
R8546:Hist1h2bl UTSW 13 21715872 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACCTTATGCCTTGTTAGGTCCAAG -3'
(R):5'- ACTCGGTGTACGTGTACAAGG -3'

Sequencing Primer
(F):5'- CTTGTTAGGTCCAAGGCAAGAG -3'
(R):5'- TACGTGTACAAGGTGCTGAAGC -3'
Posted On2020-09-15