Mutagenetix > Incidental Mutations

Incidental Mutation 'R7972:Triobp'

650680

Institutional Source

Beutler Lab

Gene Symbol

Triobp

Ensembl Gene

ENSMUSG00000033088

Gene Name

TRIO and F-actin binding protein

Synonyms

EST478828, Mus EST 478828, Tara

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7972 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

78947724-79005869 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 78967986 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 780 (I780T)

Ref Sequence

ENSEMBL: ENSMUSP00000105312 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000109689] [ENSMUST00000109690] [ENSMUST00000140228]

AlphaFold

Q99KW3

Predicted Effect

probably damaging
Transcript: ENSMUST00000109689
AA Change: I780T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000105311
Gene: ENSMUSG00000033088
AA Change: I780T

Domain	Start	End	E-Value	Type
low complexity region	130	154	N/A	INTRINSIC
low complexity region	291	311	N/A	INTRINSIC
internal_repeat_1	312	394	7.43e-13	PROSPERO
internal_repeat_1	390	540	7.43e-13	PROSPERO
low complexity region	585	600	N/A	INTRINSIC
low complexity region	638	657	N/A	INTRINSIC
low complexity region	697	729	N/A	INTRINSIC
low complexity region	767	777	N/A	INTRINSIC
low complexity region	885	901	N/A	INTRINSIC
low complexity region	903	923	N/A	INTRINSIC
low complexity region	995	1017	N/A	INTRINSIC
low complexity region	1054	1068	N/A	INTRINSIC
low complexity region	1221	1235	N/A	INTRINSIC
PH	1395	1492	6.2e-19	SMART
coiled coil region	1665	1692	N/A	INTRINSIC
coiled coil region	1727	1765	N/A	INTRINSIC
coiled coil region	1789	1851	N/A	INTRINSIC
coiled coil region	1885	1964	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000109690
AA Change: I780T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000105312
Gene: ENSMUSG00000033088
AA Change: I780T

Domain	Start	End	E-Value	Type
low complexity region	130	154	N/A	INTRINSIC
low complexity region	291	311	N/A	INTRINSIC
internal_repeat_1	312	394	9.24e-13	PROSPERO
internal_repeat_1	390	540	9.24e-13	PROSPERO
low complexity region	585	600	N/A	INTRINSIC
low complexity region	638	657	N/A	INTRINSIC
low complexity region	697	729	N/A	INTRINSIC
low complexity region	767	777	N/A	INTRINSIC
low complexity region	885	901	N/A	INTRINSIC
low complexity region	903	923	N/A	INTRINSIC
low complexity region	995	1017	N/A	INTRINSIC
low complexity region	1054	1068	N/A	INTRINSIC
low complexity region	1221	1235	N/A	INTRINSIC
PH	1441	1538	6.2e-19	SMART
coiled coil region	1711	1738	N/A	INTRINSIC
coiled coil region	1773	1811	N/A	INTRINSIC
coiled coil region	1835	1897	N/A	INTRINSIC
coiled coil region	1931	2010	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000140228
AA Change: I780T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Meta Mutation Damage Score

0.1163

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

98% (48/49)

MGI Phenotype

FUNCTION: This gene encodes a protein that interacts with trio, which is involved with neural tissue development and controlling actin cytoskeleton organization, cell motility, and cell growth. The encoded protein also associates with F-actin and stabilizes F-actin structures. Domains contained in this encoded protein are an N-terminal pleckstrin homology domain and a C-terminal coiled-coil region. Mutations in the human gene have been associated with a form of autosomal recessive nonsyndromic deafness. Multiple alternatively spliced transcript variants have been described [provided by RefSeq, Sep 2012]
PHENOTYPE: Mice homozygous for gene trapped alleles exhibit embryonic lethality. Mice homozygous for a targeted allele eliminating isoforms 4 and 5 exhibit profound deafness associated with stereocilia fragility and degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abhd16a	T	A	17: 35,101,311	V384E	probably damaging	Het
Acacb	C	T	5: 114,226,857	R1533*	probably null	Het
Alox12	T	A	11: 70,242,687	M604L	probably benign	Het
Amotl2	C	T	9: 102,723,769	T345I	probably benign	Het
Brdt	A	T	5: 107,348,549	I176F	possibly damaging	Het
Cdk5	G	T	5: 24,419,658	T245K	probably benign	Het
Chd9	A	T	8: 91,005,767	R1304S	unknown	Het
Clpsl2	G	A	17: 28,550,728	G55R	probably damaging	Het
Cyp2j11	T	A	4: 96,297,634	E438V	probably damaging	Het
Dao	AGG	AG	5: 114,015,209		probably benign	Het
Dnah10	T	C	5: 124,726,885	V92A	probably benign	Het
Dusp27	T	A	1: 166,099,139	E968V	probably damaging	Het
Evl	C	T	12: 108,681,524	R295*	probably null	Het
Fam184a	A	T	10: 53,638,259	L1022Q	probably damaging	Het
Foxd4	T	C	19: 24,900,230	H202R	probably damaging	Het
Fry	T	C	5: 150,310,396	V16A	probably benign	Het
Gstcd	A	T	3: 133,072,133	F306I	probably benign	Het
Hist1h2bl	A	G	13: 21,715,807	S113P	possibly damaging	Het
Hivep3	T	C	4: 120,097,514	V1009A	possibly damaging	Het
Hoxd12	G	T	2: 74,675,925	R227L	probably damaging	Het
Ifi208	T	A	1: 173,678,990	M113K	possibly damaging	Het
Kcnh4	T	G	11: 100,752,452	T330P	probably damaging	Het
Kctd17	CAGCTGGAGGAGC	CAGC	15: 78,436,913		probably benign	Het
Lin28a	G	A	4: 134,006,263	P158S	probably damaging	Het
Muc16	C	A	9: 18,645,764	E3078*	probably null	Het
Naaladl1	A	G	19: 6,106,244	N120S	probably damaging	Het
Nol10	G	A	12: 17,352,647	R40H	probably benign	Het
Ntng1	G	A	3: 110,135,486	S8L	probably benign	Het
Olfr1212	T	A	2: 88,958,833	Y122*	probably null	Het
Olfr1243	T	G	2: 89,527,604	I269L	probably benign	Het
Pacsin1	T	A	17: 27,708,639	F319I	unknown	Het
Pla2g4d	G	A	2: 120,278,932	T212I	probably benign	Het
Ppp4r1	T	A	17: 65,833,098	C664S	possibly damaging	Het
Prodh2	T	C	7: 30,511,155	I377T	probably damaging	Het
Prss57	A	T	10: 79,783,396	L243H	probably benign	Het
Pxdn	C	T	12: 30,006,602	L1271F	probably damaging	Het
Ros1	G	A	10: 52,154,830	R581*	probably null	Het
Rps6kc1	C	T	1: 190,799,124	G894S	probably benign	Het
Sirt7	A	G	11: 120,619,190	S183P	unknown	Het
Slc12a4	G	A	8: 105,951,605	R319W	possibly damaging	Het
Son	AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG	AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG	16: 91,660,334		probably benign	Het
Tbc1d8	A	G	1: 39,392,169	F374S	probably damaging	Het
Tdrd1	T	A	19: 56,848,702	D489E	probably damaging	Het
Tiprl	T	A	1: 165,236,974		probably benign	Het
Tpt1	T	C	14: 75,848,099	*173Q	probably null	Het
Trim17	A	G	11: 58,968,568	I203V	probably benign	Het
Trim43b	T	A	9: 89,091,308	H124L	probably damaging	Het
Ttc30a1	A	T	2: 75,980,458	M427K	probably damaging	Het
Tyrobp	G	A	7: 30,414,638	G101R		Het
Vmn1r181	A	T	7: 23,984,446	H112L	probably benign	Het
Wdr19	A	G	5: 65,223,850	N406D	probably damaging	Het
Zc3h12a	T	C	4: 125,119,935	K379E	probably benign	Het
Zcwpw1	T	C	5: 137,801,061	I230T	probably benign	Het
Zfhx4	A	G	3: 5,412,473	T3383A	probably benign	Het

Other mutations in Triobp

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01634:Triobp	APN	15	78993368	missense	probably damaging	1.00
IGL01904:Triobp	APN	15	78967364	missense	possibly damaging	0.80
IGL01957:Triobp	APN	15	78972647	critical splice donor site	probably null
IGL02085:Triobp	APN	15	78974297	splice site	probably benign
IGL02260:Triobp	APN	15	78966362	missense	probably benign	0.00
IGL02498:Triobp	APN	15	78961043	missense	probably benign	0.01
IGL02551:Triobp	APN	15	78973489	missense	probably benign
IGL02740:Triobp	APN	15	78966689	missense	probably benign	0.21
IGL02810:Triobp	APN	15	79002203	missense	possibly damaging	0.95
IGL03063:Triobp	APN	15	78990884	missense	probably damaging	1.00
FR4304:Triobp	UTSW	15	78993387	unclassified	probably benign
FR4340:Triobp	UTSW	15	78993390	unclassified	probably benign
FR4342:Triobp	UTSW	15	78993392	unclassified	probably benign
FR4449:Triobp	UTSW	15	78993389	unclassified	probably benign
FR4548:Triobp	UTSW	15	78993387	unclassified	probably benign
FR4548:Triobp	UTSW	15	78993390	unclassified	probably benign
R0276:Triobp	UTSW	15	78973676	missense	probably benign	0.09
R0309:Triobp	UTSW	15	78976540	missense	probably damaging	1.00
R0433:Triobp	UTSW	15	78968201	missense	possibly damaging	0.69
R0464:Triobp	UTSW	15	78966986	missense	possibly damaging	0.71
R0525:Triobp	UTSW	15	78973898	missense	possibly damaging	0.93
R0665:Triobp	UTSW	15	78973898	missense	possibly damaging	0.93
R0689:Triobp	UTSW	15	78959988	nonsense	probably null
R1149:Triobp	UTSW	15	78966479	missense	probably benign	0.00
R1149:Triobp	UTSW	15	78966479	missense	probably benign	0.00
R1151:Triobp	UTSW	15	78966479	missense	probably benign	0.00
R1152:Triobp	UTSW	15	78966479	missense	probably benign	0.00
R1510:Triobp	UTSW	15	79003767	missense	probably damaging	1.00
R1519:Triobp	UTSW	15	78973738	missense	probably benign	0.00
R1642:Triobp	UTSW	15	79002148	missense	probably damaging	1.00
R1732:Triobp	UTSW	15	78967228	missense	possibly damaging	0.69
R1755:Triobp	UTSW	15	78966479	missense	probably benign	0.00
R1975:Triobp	UTSW	15	78966708	missense	probably benign
R2051:Triobp	UTSW	15	79004540	missense	probably damaging	1.00
R2073:Triobp	UTSW	15	78973895	missense	probably damaging	0.99
R2260:Triobp	UTSW	15	78991440	critical splice donor site	probably null
R2351:Triobp	UTSW	15	79004580	missense	probably benign	0.09
R2902:Triobp	UTSW	15	78973418	missense	possibly damaging	0.90
R3801:Triobp	UTSW	15	78973700	missense	probably benign	0.04
R3959:Triobp	UTSW	15	79002389	nonsense	probably null
R4003:Triobp	UTSW	15	78959977	unclassified	probably benign
R4084:Triobp	UTSW	15	78973671	missense	probably benign	0.19
R4482:Triobp	UTSW	15	78966563	missense	possibly damaging	0.87
R4592:Triobp	UTSW	15	78967095	missense	probably benign
R4662:Triobp	UTSW	15	78993269	missense	probably damaging	1.00
R4732:Triobp	UTSW	15	78967113	missense	probably damaging	0.99
R4733:Triobp	UTSW	15	78967113	missense	probably damaging	0.99
R4789:Triobp	UTSW	15	78991028	missense	probably damaging	1.00
R4968:Triobp	UTSW	15	78966616	missense	probably benign	0.03
R4990:Triobp	UTSW	15	78967005	missense	probably benign	0.00
R5129:Triobp	UTSW	15	78961096	missense	probably benign	0.15
R5181:Triobp	UTSW	15	78967754	missense	probably benign	0.00
R5279:Triobp	UTSW	15	78994391	missense	possibly damaging	0.66
R5584:Triobp	UTSW	15	78968132	missense	possibly damaging	0.89
R5601:Triobp	UTSW	15	78973633	missense	probably damaging	1.00
R5810:Triobp	UTSW	15	78968267	missense	probably benign	0.07
R5969:Triobp	UTSW	15	78967540	missense	probably benign	0.05
R6722:Triobp	UTSW	15	79001565	missense	probably damaging	1.00
R6739:Triobp	UTSW	15	78966366	missense	possibly damaging	0.77
R6810:Triobp	UTSW	15	78966615	missense	possibly damaging	0.47
R7011:Triobp	UTSW	15	78978723	missense	probably damaging	0.98
R7015:Triobp	UTSW	15	78994060	missense	probably damaging	0.99
R7200:Triobp	UTSW	15	78966842	small deletion	probably benign
R7294:Triobp	UTSW	15	78973976	missense	probably damaging	0.99
R7688:Triobp	UTSW	15	78961111	splice site	probably null
R7805:Triobp	UTSW	15	78974004	missense	probably benign	0.37
R7977:Triobp	UTSW	15	79001544	missense	probably damaging	1.00
R7987:Triobp	UTSW	15	79001544	missense	probably damaging	1.00
R7999:Triobp	UTSW	15	78959944	missense	probably damaging	0.99
R8344:Triobp	UTSW	15	78958275	missense	possibly damaging	0.67
R8348:Triobp	UTSW	15	78994126	missense	possibly damaging	0.85
R8446:Triobp	UTSW	15	78994126	missense	possibly damaging	0.85
R8448:Triobp	UTSW	15	78994126	missense	possibly damaging	0.85
R8469:Triobp	UTSW	15	78967019	missense	probably benign	0.00
R8491:Triobp	UTSW	15	78994126	missense	possibly damaging	0.85
R8492:Triobp	UTSW	15	78994126	missense	possibly damaging	0.85
R8493:Triobp	UTSW	15	78994126	missense	possibly damaging	0.85
RF001:Triobp	UTSW	15	78967027	small insertion	probably benign
RF005:Triobp	UTSW	15	78967061	small insertion	probably benign
RF007:Triobp	UTSW	15	78967044	small insertion	probably benign
RF022:Triobp	UTSW	15	78974282	missense	probably benign	0.05
RF028:Triobp	UTSW	15	78967039	small insertion	probably benign
RF032:Triobp	UTSW	15	78967036	small insertion	probably benign
RF035:Triobp	UTSW	15	78967039	small insertion	probably benign
RF039:Triobp	UTSW	15	78967036	small insertion	probably benign
RF039:Triobp	UTSW	15	78967039	small insertion	probably benign
RF040:Triobp	UTSW	15	78967063	small insertion	probably benign
RF049:Triobp	UTSW	15	78967061	small insertion	probably benign
RF051:Triobp	UTSW	15	78967034	small insertion	probably benign
RF058:Triobp	UTSW	15	78967044	small insertion	probably benign
X0026:Triobp	UTSW	15	78960023	missense	possibly damaging	0.94
Z1177:Triobp	UTSW	15	79002181	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTCGTCTGAGAGTGAATCGC -3'
(R):5'- CAAGACTCTCCATACTGGTCCC -3'

Sequencing Primer
(F):5'- TCTGAGAGTGAATCGCCCCAC -3'
(R):5'- CCTGGAAGAAGAGGGAAGGCTC -3'

Posted On

2020-09-15