Incidental Mutation 'R7972:Abhd16a'
ID650684
Institutional Source Beutler Lab
Gene Symbol Abhd16a
Ensembl Gene ENSMUSG00000007036
Gene Nameabhydrolase domain containing 16A
SynonymsD17H6S82E, Bat5, NG26
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.445) question?
Stock #R7972 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location35089263-35102987 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 35101311 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 384 (V384E)
Ref Sequence ENSEMBL: ENSMUSP00000007251 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007251] [ENSMUST00000173846]
Predicted Effect probably damaging
Transcript: ENSMUST00000007251
AA Change: V384E

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000007251
Gene: ENSMUSG00000007036
AA Change: V384E

DomainStartEndE-ValueType
low complexity region 28 43 N/A INTRINSIC
transmembrane domain 60 82 N/A INTRINSIC
transmembrane domain 95 117 N/A INTRINSIC
low complexity region 165 179 N/A INTRINSIC
Pfam:Abhydrolase_1 280 415 6.3e-10 PFAM
Pfam:Abhydrolase_5 282 465 4.7e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173846
SMART Domains Protein: ENSMUSP00000133505
Gene: ENSMUSG00000007036

DomainStartEndE-ValueType
low complexity region 28 43 N/A INTRINSIC
Meta Mutation Damage Score 0.6162 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] A cluster of genes, BAT1-BAT5, has been localized in the vicinity of the genes for tumor necrosis factor alpha and tumor necrosis factor beta. These genes are all within the human major histocompatibility complex class III region. The protein encoded by this gene is thought to be involved in some aspects of immunity. Alternatively spliced transcript variants have been described. [provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial prenatal lethality, decreased body size and weight, and decreased brain lysophosphatidylserines. Macrophages display a reduction in lysophosphatidylserines and LPS-induced cytokine production. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb C T 5: 114,226,857 R1533* probably null Het
Alox12 T A 11: 70,242,687 M604L probably benign Het
Amotl2 C T 9: 102,723,769 T345I probably benign Het
Brdt A T 5: 107,348,549 I176F possibly damaging Het
Cdk5 G T 5: 24,419,658 T245K probably benign Het
Chd9 A T 8: 91,005,767 R1304S unknown Het
Clpsl2 G A 17: 28,550,728 G55R probably damaging Het
Cyp2j11 T A 4: 96,297,634 E438V probably damaging Het
Dao AGG AG 5: 114,015,209 probably benign Het
Dnah10 T C 5: 124,726,885 V92A probably benign Het
Dusp27 T A 1: 166,099,139 E968V probably damaging Het
Evl C T 12: 108,681,524 R295* probably null Het
Fam184a A T 10: 53,638,259 L1022Q probably damaging Het
Foxd4 T C 19: 24,900,230 H202R probably damaging Het
Fry T C 5: 150,310,396 V16A probably benign Het
Gstcd A T 3: 133,072,133 F306I probably benign Het
Hist1h2bl A G 13: 21,715,807 S113P possibly damaging Het
Hivep3 T C 4: 120,097,514 V1009A possibly damaging Het
Hoxd12 G T 2: 74,675,925 R227L probably damaging Het
Ifi208 T A 1: 173,678,990 M113K possibly damaging Het
Kcnh4 T G 11: 100,752,452 T330P probably damaging Het
Kctd17 CAGCTGGAGGAGC CAGC 15: 78,436,913 probably benign Het
Lin28a G A 4: 134,006,263 P158S probably damaging Het
Muc16 C A 9: 18,645,764 E3078* probably null Het
Naaladl1 A G 19: 6,106,244 N120S probably damaging Het
Nol10 G A 12: 17,352,647 R40H probably benign Het
Ntng1 G A 3: 110,135,486 S8L probably benign Het
Olfr1212 T A 2: 88,958,833 Y122* probably null Het
Olfr1243 T G 2: 89,527,604 I269L probably benign Het
Pacsin1 T A 17: 27,708,639 F319I unknown Het
Pla2g4d G A 2: 120,278,932 T212I probably benign Het
Ppp4r1 T A 17: 65,833,098 C664S possibly damaging Het
Prodh2 T C 7: 30,511,155 I377T probably damaging Het
Prss57 A T 10: 79,783,396 L243H probably benign Het
Pxdn C T 12: 30,006,602 L1271F probably damaging Het
Ros1 G A 10: 52,154,830 R581* probably null Het
Rps6kc1 C T 1: 190,799,124 G894S probably benign Het
Sirt7 A G 11: 120,619,190 S183P unknown Het
Slc12a4 G A 8: 105,951,605 R319W possibly damaging Het
Son AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,334 probably benign Het
Tbc1d8 A G 1: 39,392,169 F374S probably damaging Het
Tdrd1 T A 19: 56,848,702 D489E probably damaging Het
Tiprl T A 1: 165,236,974 probably benign Het
Tpt1 T C 14: 75,848,099 *173Q probably null Het
Trim17 A G 11: 58,968,568 I203V probably benign Het
Trim43b T A 9: 89,091,308 H124L probably damaging Het
Triobp T C 15: 78,967,986 I780T probably damaging Het
Ttc30a1 A T 2: 75,980,458 M427K probably damaging Het
Tyrobp G A 7: 30,414,638 G101R Het
Vmn1r181 A T 7: 23,984,446 H112L probably benign Het
Wdr19 A G 5: 65,223,850 N406D probably damaging Het
Zc3h12a T C 4: 125,119,935 K379E probably benign Het
Zcwpw1 T C 5: 137,801,061 I230T probably benign Het
Zfhx4 A G 3: 5,412,473 T3383A probably benign Het
Other mutations in Abhd16a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01543:Abhd16a APN 17 35091037 missense probably damaging 0.96
IGL01943:Abhd16a APN 17 35096483 missense probably benign 0.00
IGL01955:Abhd16a APN 17 35101340 missense probably damaging 1.00
IGL02563:Abhd16a APN 17 35101245 missense probably damaging 1.00
deprived UTSW 17 35098809 critical splice donor site probably null
downtrodden UTSW 17 35101851 missense probably benign 0.12
R0765:Abhd16a UTSW 17 35101851 missense probably benign 0.12
R1931:Abhd16a UTSW 17 35101015 missense probably benign 0.00
R3788:Abhd16a UTSW 17 35101587 missense probably damaging 0.99
R3789:Abhd16a UTSW 17 35101587 missense probably damaging 0.99
R4567:Abhd16a UTSW 17 35096523 missense probably damaging 1.00
R4587:Abhd16a UTSW 17 35101087 critical splice donor site probably null
R4701:Abhd16a UTSW 17 35096606 critical splice donor site probably null
R4736:Abhd16a UTSW 17 35101883 missense probably benign 0.01
R4959:Abhd16a UTSW 17 35102342 missense probably benign 0.26
R4973:Abhd16a UTSW 17 35102342 missense probably benign 0.26
R5338:Abhd16a UTSW 17 35094302 missense probably damaging 1.00
R5896:Abhd16a UTSW 17 35091725 intron probably benign
R6092:Abhd16a UTSW 17 35098810 critical splice donor site probably null
R6533:Abhd16a UTSW 17 35098809 critical splice donor site probably null
R6881:Abhd16a UTSW 17 35096601 missense probably benign 0.00
R7603:Abhd16a UTSW 17 35101960 splice site probably null
R8466:Abhd16a UTSW 17 35094260 missense probably damaging 1.00
R8721:Abhd16a UTSW 17 35091595 missense possibly damaging 0.95
Z1177:Abhd16a UTSW 17 35099001 critical splice donor site probably null
Z1177:Abhd16a UTSW 17 35102475 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCTTCACTGGTATCTGCCTC -3'
(R):5'- TAAAGGTCCCACTGTCCACTG -3'

Sequencing Primer
(F):5'- TCCCTGCGCAGTAGAGATG -3'
(R):5'- TGTCCACTGGGCAGGGAAG -3'
Posted On2020-09-15