Incidental Mutation 'R7972:Ppp4r1'
ID650685
Institutional Source Beutler Lab
Gene Symbol Ppp4r1
Ensembl Gene ENSMUSG00000061950
Gene Nameprotein phosphatase 4, regulatory subunit 1
SynonymsPp4r1, 3110001J10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7972 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location65782573-65841926 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 65833098 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 664 (C664S)
Ref Sequence ENSEMBL: ENSMUSP00000072848 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073104] [ENSMUST00000160664] [ENSMUST00000162109] [ENSMUST00000162703]
Predicted Effect possibly damaging
Transcript: ENSMUST00000073104
AA Change: C664S

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000072848
Gene: ENSMUSG00000061950
AA Change: C664S

DomainStartEndE-ValueType
low complexity region 152 163 N/A INTRINSIC
Pfam:HEAT 213 244 2e-5 PFAM
Pfam:HEAT 253 280 2.7e-6 PFAM
low complexity region 531 540 N/A INTRINSIC
PDB:3FGA|A 664 930 3e-6 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000159646
SMART Domains Protein: ENSMUSP00000123796
Gene: ENSMUSG00000061950

DomainStartEndE-ValueType
low complexity region 92 101 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160664
AA Change: C647S

PolyPhen 2 Score 0.345 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000124690
Gene: ENSMUSG00000061950
AA Change: C647S

DomainStartEndE-ValueType
low complexity region 135 146 N/A INTRINSIC
Pfam:HEAT 236 263 2.2e-6 PFAM
low complexity region 514 523 N/A INTRINSIC
PDB:3FGA|A 647 913 3e-6 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000162109
SMART Domains Protein: ENSMUSP00000125220
Gene: ENSMUSG00000061950

DomainStartEndE-ValueType
low complexity region 152 163 N/A INTRINSIC
Pfam:HEAT 253 280 7.1e-7 PFAM
Pfam:HEAT 292 322 2.1e-5 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162703
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of several alternate regulatory subunits of serine/threonine protein phosphatase 4 (PP4). The protein features multiple HEAT repeats. This protein forms a complex with PP4RC. This complex may have a distinct role from other PP4 complexes, including regulation of HDAC3 (Zhang et al., PMID: 15805470). There is also a transcribed pseudogene on chromosome 20. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2012]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd16a T A 17: 35,101,311 V384E probably damaging Het
Acacb C T 5: 114,226,857 R1533* probably null Het
Alox12 T A 11: 70,242,687 M604L probably benign Het
Amotl2 C T 9: 102,723,769 T345I probably benign Het
Brdt A T 5: 107,348,549 I176F possibly damaging Het
Cdk5 G T 5: 24,419,658 T245K probably benign Het
Chd9 A T 8: 91,005,767 R1304S unknown Het
Clpsl2 G A 17: 28,550,728 G55R probably damaging Het
Cyp2j11 T A 4: 96,297,634 E438V probably damaging Het
Dao AGG AG 5: 114,015,209 probably benign Het
Dnah10 T C 5: 124,726,885 V92A probably benign Het
Dusp27 T A 1: 166,099,139 E968V probably damaging Het
Evl C T 12: 108,681,524 R295* probably null Het
Fam184a A T 10: 53,638,259 L1022Q probably damaging Het
Foxd4 T C 19: 24,900,230 H202R probably damaging Het
Fry T C 5: 150,310,396 V16A probably benign Het
Gstcd A T 3: 133,072,133 F306I probably benign Het
Hist1h2bl A G 13: 21,715,807 S113P possibly damaging Het
Hivep3 T C 4: 120,097,514 V1009A possibly damaging Het
Hoxd12 G T 2: 74,675,925 R227L probably damaging Het
Ifi208 T A 1: 173,678,990 M113K possibly damaging Het
Kcnh4 T G 11: 100,752,452 T330P probably damaging Het
Kctd17 CAGCTGGAGGAGC CAGC 15: 78,436,913 probably benign Het
Lin28a G A 4: 134,006,263 P158S probably damaging Het
Muc16 C A 9: 18,645,764 E3078* probably null Het
Naaladl1 A G 19: 6,106,244 N120S probably damaging Het
Nol10 G A 12: 17,352,647 R40H probably benign Het
Ntng1 G A 3: 110,135,486 S8L probably benign Het
Olfr1212 T A 2: 88,958,833 Y122* probably null Het
Olfr1243 T G 2: 89,527,604 I269L probably benign Het
Pacsin1 T A 17: 27,708,639 F319I unknown Het
Pla2g4d G A 2: 120,278,932 T212I probably benign Het
Prodh2 T C 7: 30,511,155 I377T probably damaging Het
Prss57 A T 10: 79,783,396 L243H probably benign Het
Pxdn C T 12: 30,006,602 L1271F probably damaging Het
Ros1 G A 10: 52,154,830 R581* probably null Het
Rps6kc1 C T 1: 190,799,124 G894S probably benign Het
Sirt7 A G 11: 120,619,190 S183P unknown Het
Slc12a4 G A 8: 105,951,605 R319W possibly damaging Het
Son AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,334 probably benign Het
Tbc1d8 A G 1: 39,392,169 F374S probably damaging Het
Tdrd1 T A 19: 56,848,702 D489E probably damaging Het
Tiprl T A 1: 165,236,974 probably benign Het
Tpt1 T C 14: 75,848,099 *173Q probably null Het
Trim17 A G 11: 58,968,568 I203V probably benign Het
Trim43b T A 9: 89,091,308 H124L probably damaging Het
Triobp T C 15: 78,967,986 I780T probably damaging Het
Ttc30a1 A T 2: 75,980,458 M427K probably damaging Het
Tyrobp G A 7: 30,414,638 G101R Het
Vmn1r181 A T 7: 23,984,446 H112L probably benign Het
Wdr19 A G 5: 65,223,850 N406D probably damaging Het
Zc3h12a T C 4: 125,119,935 K379E probably benign Het
Zcwpw1 T C 5: 137,801,061 I230T probably benign Het
Zfhx4 A G 3: 5,412,473 T3383A probably benign Het
Other mutations in Ppp4r1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Ppp4r1 APN 17 65816019 missense probably benign 0.06
IGL01415:Ppp4r1 APN 17 65813527 missense probably damaging 1.00
IGL02166:Ppp4r1 APN 17 65813492 missense probably benign 0.01
IGL02672:Ppp4r1 APN 17 65840947 missense probably damaging 1.00
estancia UTSW 17 65803968 critical splice donor site probably null
Hacienda UTSW 17 65816006 missense probably benign
R0304:Ppp4r1 UTSW 17 65816006 missense probably benign
R0976:Ppp4r1 UTSW 17 65841018 makesense probably null
R1355:Ppp4r1 UTSW 17 65840987 missense probably benign
R2356:Ppp4r1 UTSW 17 65833050 missense probably damaging 0.99
R2405:Ppp4r1 UTSW 17 65811346 missense possibly damaging 0.95
R3054:Ppp4r1 UTSW 17 65836079 missense probably damaging 0.99
R4391:Ppp4r1 UTSW 17 65824754 missense probably benign 0.05
R4603:Ppp4r1 UTSW 17 65813464 missense probably damaging 1.00
R4763:Ppp4r1 UTSW 17 65835110 missense possibly damaging 0.90
R5571:Ppp4r1 UTSW 17 65803861 nonsense probably null
R5586:Ppp4r1 UTSW 17 65824568 missense probably benign 0.00
R5661:Ppp4r1 UTSW 17 65803968 critical splice donor site probably null
R5742:Ppp4r1 UTSW 17 65837746 missense probably damaging 0.97
R5971:Ppp4r1 UTSW 17 65814348 missense possibly damaging 0.89
R6079:Ppp4r1 UTSW 17 65814348 missense possibly damaging 0.89
R6138:Ppp4r1 UTSW 17 65814348 missense possibly damaging 0.89
R6303:Ppp4r1 UTSW 17 65824729 missense probably benign 0.10
R6684:Ppp4r1 UTSW 17 65824342 missense probably benign 0.00
R7058:Ppp4r1 UTSW 17 65829500 missense probably benign 0.00
R7397:Ppp4r1 UTSW 17 65837791 missense probably benign 0.28
R7448:Ppp4r1 UTSW 17 65840941 missense probably damaging 1.00
R7465:Ppp4r1 UTSW 17 65831020 nonsense probably null
R7528:Ppp4r1 UTSW 17 65813498 missense probably damaging 1.00
R7571:Ppp4r1 UTSW 17 65810616 missense possibly damaging 0.91
R7910:Ppp4r1 UTSW 17 65811303 missense probably benign 0.00
R7910:Ppp4r1 UTSW 17 65829399 missense probably damaging 1.00
R8910:Ppp4r1 UTSW 17 65837773 missense probably damaging 1.00
R8915:Ppp4r1 UTSW 17 65829381 missense probably damaging 0.99
R8939:Ppp4r1 UTSW 17 65803931 missense probably damaging 1.00
U15987:Ppp4r1 UTSW 17 65814348 missense possibly damaging 0.89
Z1176:Ppp4r1 UTSW 17 65838926 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGTTCAAATGTGCTATGTCCC -3'
(R):5'- ATACAGGACTACAATGACAAGTGC -3'

Sequencing Primer
(F):5'- GCACAGACAGTTGACACT -3'
(R):5'- GGACTACAATGACAAGTGCTTTCTGG -3'
Posted On2020-09-15