Incidental Mutation 'R7972:Tdrd1'
ID650688
Institutional Source Beutler Lab
Gene Symbol Tdrd1
Ensembl Gene ENSMUSG00000025081
Gene Nametudor domain containing 1
SynonymsMTR-1
MMRRC Submission
Accession Numbers

Genbank: NM_001002238

Is this an essential gene? Possibly non essential (E-score: 0.430) question?
Stock #R7972 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location56826209-56870012 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 56848702 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 489 (D489E)
Ref Sequence ENSEMBL: ENSMUSP00000077785 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078723] [ENSMUST00000111604] [ENSMUST00000111606] [ENSMUST00000121249]
PDB Structure Structure of extended Tudor domain TD3 from mouse TDRD1 in complex with MILI peptide containing dimethylarginine 45. [X-RAY DIFFRACTION]
Structure of extended Tudor domain TD3 from mouse TDRD1 [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000078723
AA Change: D489E

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000077785
Gene: ENSMUSG00000025081
AA Change: D489E

DomainStartEndE-ValueType
low complexity region 75 86 N/A INTRINSIC
low complexity region 103 117 N/A INTRINSIC
Pfam:zf-MYND 163 199 3.5e-13 PFAM
TUDOR 306 365 6.45e-11 SMART
TUDOR 537 593 4.88e-11 SMART
low complexity region 698 714 N/A INTRINSIC
low complexity region 728 739 N/A INTRINSIC
TUDOR 755 813 3.97e-11 SMART
TUDOR 981 1038 1.27e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111604
AA Change: D489E

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000107231
Gene: ENSMUSG00000025081
AA Change: D489E

DomainStartEndE-ValueType
low complexity region 75 86 N/A INTRINSIC
low complexity region 103 117 N/A INTRINSIC
Pfam:zf-MYND 163 199 3.5e-13 PFAM
TUDOR 306 365 6.45e-11 SMART
TUDOR 537 593 4.88e-11 SMART
low complexity region 698 714 N/A INTRINSIC
low complexity region 728 739 N/A INTRINSIC
TUDOR 755 813 3.97e-11 SMART
TUDOR 981 1038 1.27e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111606
AA Change: D489E

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000107233
Gene: ENSMUSG00000025081
AA Change: D489E

DomainStartEndE-ValueType
low complexity region 75 86 N/A INTRINSIC
low complexity region 103 117 N/A INTRINSIC
Pfam:zf-MYND 163 199 3.5e-13 PFAM
TUDOR 306 365 6.45e-11 SMART
TUDOR 537 593 4.88e-11 SMART
low complexity region 698 714 N/A INTRINSIC
low complexity region 728 739 N/A INTRINSIC
TUDOR 755 813 3.97e-11 SMART
TUDOR 981 1038 1.27e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000121249
AA Change: D489E

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112786
Gene: ENSMUSG00000025081
AA Change: D489E

DomainStartEndE-ValueType
low complexity region 75 86 N/A INTRINSIC
low complexity region 103 117 N/A INTRINSIC
Pfam:zf-MYND 163 199 9.9e-13 PFAM
TUDOR 306 365 6.45e-11 SMART
TUDOR 537 593 4.88e-11 SMART
low complexity region 698 714 N/A INTRINSIC
low complexity region 728 739 N/A INTRINSIC
TUDOR 755 813 3.97e-11 SMART
TUDOR 981 1038 1.27e-9 SMART
Meta Mutation Damage Score 0.3506 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is similar to a mouse gene that encodes a tudor domain protein. Alternatively spliced transcript variants have been described but their full length sequences have not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Male homozygous mice are sterile, displaying postnatal spermatogenic defects. Females are fertile. [provided by MGI curators]
Allele List at MGI

 All alleles(3) : Targeted, knock-out(1) Targeted, other(2)

Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd16a T A 17: 35,101,311 V384E probably damaging Het
Acacb C T 5: 114,226,857 R1533* probably null Het
Alox12 T A 11: 70,242,687 M604L probably benign Het
Amotl2 C T 9: 102,723,769 T345I probably benign Het
Brdt A T 5: 107,348,549 I176F possibly damaging Het
Cdk5 G T 5: 24,419,658 T245K probably benign Het
Chd9 A T 8: 91,005,767 R1304S unknown Het
Clpsl2 G A 17: 28,550,728 G55R probably damaging Het
Cyp2j11 T A 4: 96,297,634 E438V probably damaging Het
Dao AGG AG 5: 114,015,209 probably benign Het
Dnah10 T C 5: 124,726,885 V92A probably benign Het
Dusp27 T A 1: 166,099,139 E968V probably damaging Het
Evl C T 12: 108,681,524 R295* probably null Het
Fam184a A T 10: 53,638,259 L1022Q probably damaging Het
Foxd4 T C 19: 24,900,230 H202R probably damaging Het
Fry T C 5: 150,310,396 V16A probably benign Het
Gstcd A T 3: 133,072,133 F306I probably benign Het
Hist1h2bl A G 13: 21,715,807 S113P possibly damaging Het
Hivep3 T C 4: 120,097,514 V1009A possibly damaging Het
Hoxd12 G T 2: 74,675,925 R227L probably damaging Het
Ifi208 T A 1: 173,678,990 M113K possibly damaging Het
Kcnh4 T G 11: 100,752,452 T330P probably damaging Het
Kctd17 CAGCTGGAGGAGC CAGC 15: 78,436,913 probably benign Het
Lin28a G A 4: 134,006,263 P158S probably damaging Het
Muc16 C A 9: 18,645,764 E3078* probably null Het
Naaladl1 A G 19: 6,106,244 N120S probably damaging Het
Nol10 G A 12: 17,352,647 R40H probably benign Het
Ntng1 G A 3: 110,135,486 S8L probably benign Het
Olfr1212 T A 2: 88,958,833 Y122* probably null Het
Olfr1243 T G 2: 89,527,604 I269L probably benign Het
Pacsin1 T A 17: 27,708,639 F319I unknown Het
Pla2g4d G A 2: 120,278,932 T212I probably benign Het
Ppp4r1 T A 17: 65,833,098 C664S possibly damaging Het
Prodh2 T C 7: 30,511,155 I377T probably damaging Het
Prss57 A T 10: 79,783,396 L243H probably benign Het
Pxdn C T 12: 30,006,602 L1271F probably damaging Het
Ros1 G A 10: 52,154,830 R581* probably null Het
Rps6kc1 C T 1: 190,799,124 G894S probably benign Het
Sirt7 A G 11: 120,619,190 S183P unknown Het
Slc12a4 G A 8: 105,951,605 R319W possibly damaging Het
Son AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,334 probably benign Het
Tbc1d8 A G 1: 39,392,169 F374S probably damaging Het
Tiprl T A 1: 165,236,974 probably benign Het
Tpt1 T C 14: 75,848,099 *173Q probably null Het
Trim17 A G 11: 58,968,568 I203V probably benign Het
Trim43b T A 9: 89,091,308 H124L probably damaging Het
Triobp T C 15: 78,967,986 I780T probably damaging Het
Ttc30a1 A T 2: 75,980,458 M427K probably damaging Het
Tyrobp G A 7: 30,414,638 G101R Het
Vmn1r181 A T 7: 23,984,446 H112L probably benign Het
Wdr19 A G 5: 65,223,850 N406D probably damaging Het
Zc3h12a T C 4: 125,119,935 K379E probably benign Het
Zcwpw1 T C 5: 137,801,061 I230T probably benign Het
Zfhx4 A G 3: 5,412,473 T3383A probably benign Het
Other mutations in Tdrd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Tdrd1 APN 19 56851464 missense possibly damaging 0.51
IGL01366:Tdrd1 APN 19 56855302 missense probably benign 0.00
IGL01569:Tdrd1 APN 19 56834409 missense probably damaging 1.00
IGL02691:Tdrd1 APN 19 56843852 missense probably damaging 0.99
3-1:Tdrd1 UTSW 19 56861695 missense probably benign
R0081:Tdrd1 UTSW 19 56831271 missense probably benign 0.16
R0139:Tdrd1 UTSW 19 56843198 missense probably benign 0.00
R0254:Tdrd1 UTSW 19 56842566 missense probably benign 0.02
R0686:Tdrd1 UTSW 19 56856051 missense probably damaging 1.00
R0735:Tdrd1 UTSW 19 56865978 nonsense probably null
R0740:Tdrd1 UTSW 19 56839099 missense probably damaging 1.00
R1241:Tdrd1 UTSW 19 56861760 missense probably benign
R1294:Tdrd1 UTSW 19 56848776 splice site probably null
R1508:Tdrd1 UTSW 19 56851358 missense probably damaging 1.00
R1655:Tdrd1 UTSW 19 56843216 nonsense probably null
R1708:Tdrd1 UTSW 19 56842289 missense probably benign 0.13
R1796:Tdrd1 UTSW 19 56837783 missense probably damaging 0.98
R1840:Tdrd1 UTSW 19 56842312 missense probably damaging 1.00
R2138:Tdrd1 UTSW 19 56842589 missense probably benign 0.30
R2201:Tdrd1 UTSW 19 56858661 missense probably benign 0.14
R2201:Tdrd1 UTSW 19 56858662 missense probably benign 0.00
R2286:Tdrd1 UTSW 19 56839119 missense probably benign 0.05
R2443:Tdrd1 UTSW 19 56841354 missense probably null 0.01
R3001:Tdrd1 UTSW 19 56861750 nonsense probably null
R3002:Tdrd1 UTSW 19 56861750 nonsense probably null
R3418:Tdrd1 UTSW 19 56831231 missense possibly damaging 0.87
R3419:Tdrd1 UTSW 19 56831231 missense possibly damaging 0.87
R3707:Tdrd1 UTSW 19 56865993 missense possibly damaging 0.86
R3978:Tdrd1 UTSW 19 56866634 missense probably benign 0.01
R4077:Tdrd1 UTSW 19 56831073 missense probably benign 0.22
R4083:Tdrd1 UTSW 19 56843230 missense probably benign
R4193:Tdrd1 UTSW 19 56851341 nonsense probably null
R5882:Tdrd1 UTSW 19 56848939 missense probably damaging 1.00
R6073:Tdrd1 UTSW 19 56843223 nonsense probably null
R6223:Tdrd1 UTSW 19 56865850 missense probably damaging 1.00
R6240:Tdrd1 UTSW 19 56841335 missense probably benign 0.00
R6953:Tdrd1 UTSW 19 56831371 missense probably damaging 0.98
R7090:Tdrd1 UTSW 19 56851401 missense probably benign 0.28
R7643:Tdrd1 UTSW 19 56837708 missense probably damaging 1.00
R7793:Tdrd1 UTSW 19 56864377 missense probably damaging 0.99
R7993:Tdrd1 UTSW 19 56866005 splice site probably null
R8076:Tdrd1 UTSW 19 56843835 missense probably damaging 0.96
R8346:Tdrd1 UTSW 19 56842267 missense probably benign 0.44
R8400:Tdrd1 UTSW 19 56848649 missense probably benign 0.05
R8553:Tdrd1 UTSW 19 56843152 missense probably damaging 0.99
R8701:Tdrd1 UTSW 19 56851484 missense possibly damaging 0.94
R8772:Tdrd1 UTSW 19 56855328 missense probably damaging 0.99
R8906:Tdrd1 UTSW 19 56842713 missense probably damaging 0.99
X0020:Tdrd1 UTSW 19 56856060 missense probably damaging 1.00
X0053:Tdrd1 UTSW 19 56865791 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- CTATTCCATTGCAGGCTGTTG -3'
(R):5'- GTGGACGAAAAGCACACCTC -3'

Sequencing Primer
(F):5'- AAACATTGAAGTTCCCTAGTCTCC -3'
(R):5'- GCACACCTCAGACACAGAAATG -3'
Posted On2020-09-15