Incidental Mutation 'R7973:Ncan'
ID 650716
Institutional Source Beutler Lab
Gene Symbol Ncan
Ensembl Gene ENSMUSG00000002341
Gene Name neurocan
Synonyms Cspg3, Cspg3-rs, neurocan, Tgfbit
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7973 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 70093085-70120873 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 70097575 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 1184 (I1184L)
Ref Sequence ENSEMBL: ENSMUSP00000002412 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002412]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000002412
AA Change: I1184L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000002412
Gene: ENSMUSG00000002341
AA Change: I1184L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 23 30 N/A INTRINSIC
IG 43 157 9.63e-6 SMART
LINK 157 254 2.22e-56 SMART
LINK 258 356 4.72e-60 SMART
low complexity region 575 586 N/A INTRINSIC
low complexity region 602 632 N/A INTRINSIC
low complexity region 663 677 N/A INTRINSIC
EGF 963 996 6.5e-5 SMART
EGF_CA 998 1034 9.77e-9 SMART
CLECT 1040 1161 1.97e-41 SMART
CCP 1167 1223 2.53e-12 SMART
low complexity region 1225 1256 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Neurocan is a chondroitin sulfate proteoglycan thought to be involved in the modulation of cell adhesion and migration.[supplied by OMIM, Jul 2002]
PHENOTYPE: Mice homozygous for targeted null mutations are viable and fertile and exhibit normal behavior and brain anatomy; however, mild defects in long term potentiation were noted. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016L21Rik A G 5: 114,946,053 D76G probably benign Het
Abcg1 T C 17: 31,104,158 V237A probably damaging Het
Adgrv1 A T 13: 81,440,225 V4414E possibly damaging Het
Akap11 A T 14: 78,515,066 H122Q Het
Amotl2 C T 9: 102,723,769 T345I probably benign Het
Arhgef4 C T 1: 34,724,437 R925W possibly damaging Het
Arid1a C T 4: 133,753,070 G181D probably damaging Het
Ash1l T A 3: 89,052,857 S2299T probably benign Het
Atf7ip C T 6: 136,561,064 Q432* probably null Het
B430306N03Rik T A 17: 48,316,455 S10T probably benign Het
Bckdk A G 7: 127,906,367 I221V probably benign Het
Brinp2 T C 1: 158,246,487 Y688C probably damaging Het
Caml C T 13: 55,631,971 L286F probably benign Het
Ccdc125 C T 13: 100,669,823 probably benign Het
Cdh24 A T 14: 54,639,020 V116E possibly damaging Het
Cenpe T A 3: 135,223,250 I305N probably damaging Het
Cep41 C T 6: 30,680,131 G33S probably damaging Het
Clec4b2 A T 6: 123,204,189 I178L probably benign Het
Dao AGG AG 5: 114,015,209 probably benign Het
Dapk1 T A 13: 60,761,563 L1330Q probably damaging Het
Evl C T 12: 108,681,524 R295* probably null Het
Fmnl1 G T 11: 103,171,158 probably benign Het
Galk1 A G 11: 116,012,609 F24L possibly damaging Het
Hyal4 T A 6: 24,755,786 M1K probably null Het
Ighe T C 12: 113,273,057 T64A Het
Iqch A G 9: 63,524,946 I389T possibly damaging Het
Ism2 G T 12: 87,286,995 T92K possibly damaging Het
Kctd17 CAGCTGGAGGAGC CAGC 15: 78,436,913 probably benign Het
Kdm1b T C 13: 47,077,446 S650P probably benign Het
Mapkapk5 T G 5: 121,525,713 N426T possibly damaging Het
Mroh5 G T 15: 73,792,765 Y90* probably null Het
Nectin3 T C 16: 46,396,121 T439A probably benign Het
Neo1 G T 9: 58,990,193 A160E probably damaging Het
Nosip T C 7: 45,077,360 S295P possibly damaging Het
Nup205 T A 6: 35,245,339 F1979L probably benign Het
Nxpe2 A T 9: 48,319,868 D400E probably damaging Het
Olfr1246 T A 2: 89,590,987 I43F probably damaging Het
Pfkfb4 G A 9: 109,025,111 R351Q probably damaging Het
Psg29 T C 7: 17,210,537 I324T probably benign Het
Ptprh G T 7: 4,580,888 T235N possibly damaging Het
Ralgapa2 T A 2: 146,388,561 N981I possibly damaging Het
Ralgps1 T C 2: 33,146,639 Y421C probably damaging Het
Sf3b3 T C 8: 110,816,290 E845G possibly damaging Het
Sgk1 G T 10: 21,994,155 S31I probably benign Het
Sim1 T G 10: 50,981,323 Y390D probably damaging Het
Slain2 T A 5: 72,955,436 Y271* probably null Het
Slc12a4 G A 8: 105,951,605 R319W possibly damaging Het
St6gal1 G A 16: 23,357,835 A393T probably benign Het
Stab1 A T 14: 31,159,633 probably null Het
Supv3l1 A T 10: 62,449,423 L88Q probably damaging Het
Syt2 C A 1: 134,740,832 probably null Het
Tpr C T 1: 150,403,887 R256C probably damaging Het
Tubg1 G T 11: 101,124,028 A199S probably benign Het
Usp32 A G 11: 85,022,808 I899T probably damaging Het
Usp6nl G T 2: 6,408,951 R96M probably damaging Het
Vmn1r75 A G 7: 11,881,034 D231G probably benign Het
Vmn2r42 T C 7: 8,194,873 E249G probably benign Het
Zbtb34 C T 2: 33,411,519 G337R probably benign Het
Zfp457 T A 13: 67,293,818 H231L probably benign Het
Zfp715 C T 7: 43,299,897 G213D possibly damaging Het
Zfp760 T G 17: 21,722,103 H86Q probably benign Het
Other mutations in Ncan
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Ncan APN 8 70115271 missense probably benign 0.24
IGL00924:Ncan APN 8 70108389 missense possibly damaging 0.78
IGL01319:Ncan APN 8 70097562 missense probably damaging 0.99
IGL01407:Ncan APN 8 70101957 missense probably benign 0.17
IGL01528:Ncan APN 8 70110081 missense probably benign 0.00
IGL01567:Ncan APN 8 70108334 missense probably benign 0.09
IGL01808:Ncan APN 8 70107440 critical splice donor site probably null
IGL02543:Ncan APN 8 70108571 missense probably benign 0.37
IGL02551:Ncan APN 8 70102462 missense probably damaging 1.00
IGL02899:Ncan APN 8 70115048 missense possibly damaging 0.95
IGL02940:Ncan APN 8 70110085 missense probably benign 0.02
IGL03058:Ncan APN 8 70107932 missense possibly damaging 0.83
learned UTSW 8 70098081 nonsense probably null
sagacious UTSW 8 70112590 missense probably damaging 0.99
R0219:Ncan UTSW 8 70115334 missense probably benign 0.08
R0538:Ncan UTSW 8 70108602 missense possibly damaging 0.86
R0540:Ncan UTSW 8 70115159 missense possibly damaging 0.93
R0854:Ncan UTSW 8 70112552 missense probably damaging 1.00
R0918:Ncan UTSW 8 70108389 missense possibly damaging 0.78
R1344:Ncan UTSW 8 70108169 missense probably benign
R1575:Ncan UTSW 8 70110198 missense probably benign 0.27
R1739:Ncan UTSW 8 70108086 missense probably benign 0.03
R1847:Ncan UTSW 8 70102454 missense probably damaging 0.96
R1859:Ncan UTSW 8 70115348 missense possibly damaging 0.94
R2320:Ncan UTSW 8 70108218 missense probably benign
R2370:Ncan UTSW 8 70112813 missense probably benign 0.05
R3407:Ncan UTSW 8 70112151 missense probably damaging 1.00
R3408:Ncan UTSW 8 70112151 missense probably damaging 1.00
R3961:Ncan UTSW 8 70110300 missense probably benign 0.05
R4155:Ncan UTSW 8 70110077 missense possibly damaging 0.87
R4156:Ncan UTSW 8 70110077 missense possibly damaging 0.87
R4365:Ncan UTSW 8 70115211 missense probably damaging 1.00
R4858:Ncan UTSW 8 70104055 missense probably benign 0.00
R4925:Ncan UTSW 8 70109954 missense probably benign 0.02
R4942:Ncan UTSW 8 70100294 missense probably damaging 1.00
R4976:Ncan UTSW 8 70115025 missense probably damaging 0.98
R5119:Ncan UTSW 8 70115025 missense probably damaging 0.98
R5141:Ncan UTSW 8 70112837 missense probably damaging 1.00
R5679:Ncan UTSW 8 70112626 missense probably damaging 1.00
R5706:Ncan UTSW 8 70102017 missense probably damaging 0.99
R5915:Ncan UTSW 8 70098081 nonsense probably null
R6033:Ncan UTSW 8 70112590 missense probably damaging 0.99
R6033:Ncan UTSW 8 70112590 missense probably damaging 0.99
R6223:Ncan UTSW 8 70109954 missense probably benign 0.02
R6390:Ncan UTSW 8 70115249 missense probably benign 0.34
R6533:Ncan UTSW 8 70096357 missense probably benign 0.01
R6836:Ncan UTSW 8 70100315 missense possibly damaging 0.84
R6869:Ncan UTSW 8 70107907 missense probably benign 0.08
R7229:Ncan UTSW 8 70100311 missense possibly damaging 0.69
R7232:Ncan UTSW 8 70112088 missense probably damaging 1.00
R7293:Ncan UTSW 8 70115211 missense probably damaging 0.98
R7406:Ncan UTSW 8 70110099 missense probably benign 0.00
R7474:Ncan UTSW 8 70102041 missense possibly damaging 0.53
R7779:Ncan UTSW 8 70115011 missense probably damaging 0.99
R8113:Ncan UTSW 8 70108571 missense possibly damaging 0.58
R8269:Ncan UTSW 8 70107680 missense probably benign 0.01
R8947:Ncan UTSW 8 70102521 missense probably damaging 0.98
R9324:Ncan UTSW 8 70107998 missense possibly damaging 0.75
R9717:Ncan UTSW 8 70101978 missense probably damaging 1.00
R9803:Ncan UTSW 8 70108101 missense probably benign 0.06
Z1177:Ncan UTSW 8 70097472 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAACGACTGGGATCCTGCTG -3'
(R):5'- GCTGCTGGTTTATGTAAAAGGCAAG -3'

Sequencing Primer
(F):5'- TGGGGACAGGGTATCCAGC -3'
(R):5'- CCAAAGTCATTTGTAGTTCTGTGAGC -3'
Posted On 2020-09-15