Incidental Mutation 'R7973:Pfkfb4'
ID650723
Institutional Source Beutler Lab
Gene Symbol Pfkfb4
Ensembl Gene ENSMUSG00000025648
Gene Name6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7973 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location108991778-109032228 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 109025111 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 351 (R351Q)
Ref Sequence ENSEMBL: ENSMUSP00000142378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051873] [ENSMUST00000196249] [ENSMUST00000198140] [ENSMUST00000199591]
Predicted Effect probably damaging
Transcript: ENSMUST00000051873
AA Change: R335Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000057197
Gene: ENSMUSG00000025648
AA Change: R335Q

DomainStartEndE-ValueType
Pfam:6PF2K 28 249 3.2e-105 PFAM
Pfam:AAA_33 41 199 2.3e-8 PFAM
PGAM 251 398 4.39e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000196249
Predicted Effect probably damaging
Transcript: ENSMUST00000198140
AA Change: R351Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142378
Gene: ENSMUSG00000025648
AA Change: R351Q

DomainStartEndE-ValueType
Pfam:6PF2K 28 249 1.9e-105 PFAM
Pfam:AAA_33 41 198 8.5e-10 PFAM
PGAM 251 398 4.39e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000199591
AA Change: R351Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142992
Gene: ENSMUSG00000025648
AA Change: R351Q

DomainStartEndE-ValueType
Pfam:6PF2K 28 249 1.4e-105 PFAM
Pfam:AAA_33 41 198 6.6e-10 PFAM
PGAM 251 396 4.98e-6 SMART
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of four bifunctional kinase/phosphatases that regulate the concentration of the glycolytic byproduct fructose-2,6-bisphosphate (F2,6BP). The encoded protein is highly expressed in cancer cells and is induced by hypoxia. This protein is essential to the survival of cancer cells under conditions of hypoxia, because it increases the amount of F2,6BP and ATP at a time when the cell cannot produce much of them. This finding suggests that this protein may be a good target for disruption in cancer cells, hopefully imperiling their survival. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016L21Rik A G 5: 114,946,053 D76G probably benign Het
Abcg1 T C 17: 31,104,158 V237A probably damaging Het
Adgrv1 A T 13: 81,440,225 V4414E possibly damaging Het
Akap11 A T 14: 78,515,066 H122Q Het
Amotl2 C T 9: 102,723,769 T345I probably benign Het
Arhgef4 C T 1: 34,724,437 R925W possibly damaging Het
Arid1a C T 4: 133,753,070 G181D probably damaging Het
Ash1l T A 3: 89,052,857 S2299T probably benign Het
Atf7ip C T 6: 136,561,064 Q432* probably null Het
B430306N03Rik T A 17: 48,316,455 S10T probably benign Het
Bckdk A G 7: 127,906,367 I221V probably benign Het
Brinp2 T C 1: 158,246,487 Y688C probably damaging Het
Caml C T 13: 55,631,971 L286F probably benign Het
Ccdc125 C T 13: 100,669,823 probably benign Het
Cdh24 A T 14: 54,639,020 V116E possibly damaging Het
Cenpe T A 3: 135,223,250 I305N probably damaging Het
Cep41 C T 6: 30,680,131 G33S probably damaging Het
Clec4b2 A T 6: 123,204,189 I178L probably benign Het
Dao AGG AG 5: 114,015,209 probably benign Het
Dapk1 T A 13: 60,761,563 L1330Q probably damaging Het
Evl C T 12: 108,681,524 R295* probably null Het
Fmnl1 G T 11: 103,171,158 probably benign Het
Galk1 A G 11: 116,012,609 F24L possibly damaging Het
Hyal4 T A 6: 24,755,786 M1K probably null Het
Ighe T C 12: 113,273,057 T64A Het
Iqch A G 9: 63,524,946 I389T possibly damaging Het
Ism2 G T 12: 87,286,995 T92K possibly damaging Het
Kctd17 CAGCTGGAGGAGC CAGC 15: 78,436,913 probably benign Het
Kdm1b T C 13: 47,077,446 S650P probably benign Het
Mapkapk5 T G 5: 121,525,713 N426T possibly damaging Het
Mroh5 G T 15: 73,792,765 Y90* probably null Het
Ncan T G 8: 70,097,575 I1184L probably benign Het
Nectin3 T C 16: 46,396,121 T439A probably benign Het
Neo1 G T 9: 58,990,193 A160E probably damaging Het
Nosip T C 7: 45,077,360 S295P possibly damaging Het
Nup205 T A 6: 35,245,339 F1979L probably benign Het
Nxpe2 A T 9: 48,319,868 D400E probably damaging Het
Olfr1246 T A 2: 89,590,987 I43F probably damaging Het
Psg29 T C 7: 17,210,537 I324T probably benign Het
Ptprh G T 7: 4,580,888 T235N possibly damaging Het
Ralgapa2 T A 2: 146,388,561 N981I possibly damaging Het
Ralgps1 T C 2: 33,146,639 Y421C probably damaging Het
Sf3b3 T C 8: 110,816,290 E845G possibly damaging Het
Sgk1 G T 10: 21,994,155 S31I probably benign Het
Sim1 T G 10: 50,981,323 Y390D probably damaging Het
Slain2 T A 5: 72,955,436 Y271* probably null Het
Slc12a4 G A 8: 105,951,605 R319W possibly damaging Het
St6gal1 G A 16: 23,357,835 A393T probably benign Het
Stab1 A T 14: 31,159,633 probably null Het
Supv3l1 A T 10: 62,449,423 L88Q probably damaging Het
Syt2 C A 1: 134,740,832 probably null Het
Tpr C T 1: 150,403,887 R256C probably damaging Het
Tubg1 G T 11: 101,124,028 A199S probably benign Het
Usp32 A G 11: 85,022,808 I899T probably damaging Het
Usp6nl G T 2: 6,408,951 R96M probably damaging Het
Vmn1r75 A G 7: 11,881,034 D231G probably benign Het
Vmn2r42 T C 7: 8,194,873 E249G probably benign Het
Zbtb34 C T 2: 33,411,519 G337R probably benign Het
Zfp457 T A 13: 67,293,818 H231L probably benign Het
Zfp715 C T 7: 43,299,897 G213D possibly damaging Het
Zfp760 T G 17: 21,722,103 H86Q probably benign Het
Other mutations in Pfkfb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01653:Pfkfb4 APN 9 108999134 missense probably damaging 1.00
IGL01978:Pfkfb4 APN 9 109028942 missense probably damaging 1.00
IGL02119:Pfkfb4 APN 9 109025110 missense probably damaging 1.00
IGL02121:Pfkfb4 APN 9 109025110 missense probably damaging 1.00
IGL02122:Pfkfb4 APN 9 109025110 missense probably damaging 1.00
IGL02123:Pfkfb4 APN 9 109025110 missense probably damaging 1.00
IGL02125:Pfkfb4 APN 9 109025110 missense probably damaging 1.00
IGL02126:Pfkfb4 APN 9 109025110 missense probably damaging 1.00
IGL02506:Pfkfb4 APN 9 109030336 missense probably benign 0.00
IGL02881:Pfkfb4 APN 9 109007296 missense probably null 1.00
PIT4466001:Pfkfb4 UTSW 9 108999154 missense probably benign 0.12
PIT4472001:Pfkfb4 UTSW 9 108999154 missense probably benign 0.12
R0087:Pfkfb4 UTSW 9 109007701 missense probably damaging 1.00
R0101:Pfkfb4 UTSW 9 109010643 missense probably benign 0.03
R0109:Pfkfb4 UTSW 9 108998889 missense probably benign 0.27
R0109:Pfkfb4 UTSW 9 108998889 missense probably benign 0.27
R0379:Pfkfb4 UTSW 9 109027742 splice site probably benign
R0511:Pfkfb4 UTSW 9 109027757 missense probably damaging 1.00
R1146:Pfkfb4 UTSW 9 109007726 missense probably benign 0.00
R1146:Pfkfb4 UTSW 9 109007726 missense probably benign 0.00
R1490:Pfkfb4 UTSW 9 109027620 missense probably damaging 1.00
R1521:Pfkfb4 UTSW 9 109007305 missense probably damaging 1.00
R1932:Pfkfb4 UTSW 9 108999169 missense probably damaging 1.00
R2214:Pfkfb4 UTSW 9 109005609 missense probably benign 0.17
R3112:Pfkfb4 UTSW 9 109025042 splice site probably benign
R5470:Pfkfb4 UTSW 9 109027593 missense probably damaging 1.00
R5646:Pfkfb4 UTSW 9 109008421 missense probably damaging 1.00
R5930:Pfkfb4 UTSW 9 109030394 unclassified probably benign
R6139:Pfkfb4 UTSW 9 109027757 missense probably damaging 1.00
R6632:Pfkfb4 UTSW 9 109009562 splice site probably null
R6873:Pfkfb4 UTSW 9 109010335 splice site probably null
R6958:Pfkfb4 UTSW 9 109010547 missense probably damaging 1.00
R7098:Pfkfb4 UTSW 9 108999154 missense probably benign 0.05
R7131:Pfkfb4 UTSW 9 109007302 missense probably benign 0.21
R7148:Pfkfb4 UTSW 9 109027608 missense probably damaging 0.99
R7284:Pfkfb4 UTSW 9 109011240 missense possibly damaging 0.88
R7903:Pfkfb4 UTSW 9 108998951 missense probably damaging 1.00
R8506:Pfkfb4 UTSW 9 109005599 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- CCACACAGTGTCAGATTTGTGC -3'
(R):5'- ACATCCAGGAGACAGAGCTG -3'

Sequencing Primer
(F):5'- ATTTGTGCTAGGAGGGTCCCAC -3'
(R):5'- CAGAGCTGGGAACTGATGG -3'
Posted On2020-09-15