Incidental Mutation 'R7973:Usp32'
ID 650727
Institutional Source Beutler Lab
Gene Symbol Usp32
Ensembl Gene ENSMUSG00000000804
Gene Name ubiquitin specific peptidase 32
Synonyms 6430526O11Rik, 2900074J03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7973 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 84984442-85140161 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 85022808 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 899 (I899T)
Ref Sequence ENSEMBL: ENSMUSP00000103710 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108075]
AlphaFold F8VPZ3
Predicted Effect
SMART Domains Protein: ENSMUSP00000000821
Gene: ENSMUSG00000000804
AA Change: I197T

DomainStartEndE-ValueType
Pfam:UCH 32 260 4.1e-51 PFAM
Pfam:UCH_1 33 228 1.7e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108075
AA Change: I899T

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000103710
Gene: ENSMUSG00000000804
AA Change: I899T

DomainStartEndE-ValueType
EFh 232 260 4.66e0 SMART
EFh 268 296 5.8e-1 SMART
Blast:EFh 318 346 5e-7 BLAST
DUSP 389 588 2.32e-16 SMART
Pfam:Ubiquitin_3 628 711 2.4e-9 PFAM
Pfam:UCH 733 1564 2.4e-83 PFAM
Pfam:UCH_1 1202 1547 2.9e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174602
SMART Domains Protein: ENSMUSP00000134476
Gene: ENSMUSG00000000804

DomainStartEndE-ValueType
Pfam:DUSP 1 65 6.5e-17 PFAM
Pfam:Ubiquitin_3 122 216 8e-10 PFAM
Pfam:UCH 238 257 1.2e-7 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (53/54)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016L21Rik A G 5: 114,946,053 D76G probably benign Het
Abcg1 T C 17: 31,104,158 V237A probably damaging Het
Adgrv1 A T 13: 81,440,225 V4414E possibly damaging Het
Akap11 A T 14: 78,515,066 H122Q Het
Amotl2 C T 9: 102,723,769 T345I probably benign Het
Arhgef4 C T 1: 34,724,437 R925W possibly damaging Het
Arid1a C T 4: 133,753,070 G181D probably damaging Het
Ash1l T A 3: 89,052,857 S2299T probably benign Het
Atf7ip C T 6: 136,561,064 Q432* probably null Het
B430306N03Rik T A 17: 48,316,455 S10T probably benign Het
Bckdk A G 7: 127,906,367 I221V probably benign Het
Brinp2 T C 1: 158,246,487 Y688C probably damaging Het
Caml C T 13: 55,631,971 L286F probably benign Het
Ccdc125 C T 13: 100,669,823 probably benign Het
Cdh24 A T 14: 54,639,020 V116E possibly damaging Het
Cenpe T A 3: 135,223,250 I305N probably damaging Het
Cep41 C T 6: 30,680,131 G33S probably damaging Het
Clec4b2 A T 6: 123,204,189 I178L probably benign Het
Dao AGG AG 5: 114,015,209 probably benign Het
Dapk1 T A 13: 60,761,563 L1330Q probably damaging Het
Evl C T 12: 108,681,524 R295* probably null Het
Fmnl1 G T 11: 103,171,158 probably benign Het
Galk1 A G 11: 116,012,609 F24L possibly damaging Het
Hyal4 T A 6: 24,755,786 M1K probably null Het
Ighe T C 12: 113,273,057 T64A Het
Iqch A G 9: 63,524,946 I389T possibly damaging Het
Ism2 G T 12: 87,286,995 T92K possibly damaging Het
Kctd17 CAGCTGGAGGAGC CAGC 15: 78,436,913 probably benign Het
Kdm1b T C 13: 47,077,446 S650P probably benign Het
Mapkapk5 T G 5: 121,525,713 N426T possibly damaging Het
Mroh5 G T 15: 73,792,765 Y90* probably null Het
Ncan T G 8: 70,097,575 I1184L probably benign Het
Nectin3 T C 16: 46,396,121 T439A probably benign Het
Neo1 G T 9: 58,990,193 A160E probably damaging Het
Nosip T C 7: 45,077,360 S295P possibly damaging Het
Nup205 T A 6: 35,245,339 F1979L probably benign Het
Nxpe2 A T 9: 48,319,868 D400E probably damaging Het
Olfr1246 T A 2: 89,590,987 I43F probably damaging Het
Pfkfb4 G A 9: 109,025,111 R351Q probably damaging Het
Psg29 T C 7: 17,210,537 I324T probably benign Het
Ptprh G T 7: 4,580,888 T235N possibly damaging Het
Ralgapa2 T A 2: 146,388,561 N981I possibly damaging Het
Ralgps1 T C 2: 33,146,639 Y421C probably damaging Het
Sf3b3 T C 8: 110,816,290 E845G possibly damaging Het
Sgk1 G T 10: 21,994,155 S31I probably benign Het
Sim1 T G 10: 50,981,323 Y390D probably damaging Het
Slain2 T A 5: 72,955,436 Y271* probably null Het
Slc12a4 G A 8: 105,951,605 R319W possibly damaging Het
St6gal1 G A 16: 23,357,835 A393T probably benign Het
Stab1 A T 14: 31,159,633 probably null Het
Supv3l1 A T 10: 62,449,423 L88Q probably damaging Het
Syt2 C A 1: 134,740,832 probably null Het
Tpr C T 1: 150,403,887 R256C probably damaging Het
Tubg1 G T 11: 101,124,028 A199S probably benign Het
Usp6nl G T 2: 6,408,951 R96M probably damaging Het
Vmn1r75 A G 7: 11,881,034 D231G probably benign Het
Vmn2r42 T C 7: 8,194,873 E249G probably benign Het
Zbtb34 C T 2: 33,411,519 G337R probably benign Het
Zfp457 T A 13: 67,293,818 H231L probably benign Het
Zfp715 C T 7: 43,299,897 G213D possibly damaging Het
Zfp760 T G 17: 21,722,103 H86Q probably benign Het
Other mutations in Usp32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00529:Usp32 APN 11 84994426 missense probably damaging 1.00
IGL00701:Usp32 APN 11 85059125 splice site probably null
IGL00848:Usp32 APN 11 85051181 splice site probably benign
IGL00934:Usp32 APN 11 85007076 missense probably damaging 1.00
IGL01019:Usp32 APN 11 85039265 missense probably damaging 0.97
IGL01302:Usp32 APN 11 84988482 missense probably benign 0.05
IGL01444:Usp32 APN 11 85059164 missense probably damaging 0.97
IGL01575:Usp32 APN 11 85022802 missense probably damaging 1.00
IGL01981:Usp32 APN 11 85036524 missense probably benign 0.02
IGL02118:Usp32 APN 11 85032177 nonsense probably null
IGL02159:Usp32 APN 11 85005802 splice site probably null
IGL02227:Usp32 APN 11 84986481 missense probably damaging 1.00
IGL02363:Usp32 APN 11 85044787 missense probably benign 0.01
IGL02524:Usp32 APN 11 85010011 nonsense probably null
IGL02613:Usp32 APN 11 85040070 missense probably damaging 0.99
IGL02720:Usp32 APN 11 85006991 critical splice donor site probably null
IGL02738:Usp32 APN 11 85083806 missense probably damaging 1.00
IGL02929:Usp32 APN 11 84988372 missense probably benign 0.01
IGL03303:Usp32 APN 11 85022832 missense probably damaging 1.00
BB010:Usp32 UTSW 11 85007059 missense probably damaging 1.00
BB020:Usp32 UTSW 11 85007059 missense probably damaging 1.00
PIT4812001:Usp32 UTSW 11 85010074 missense probably damaging 1.00
R0026:Usp32 UTSW 11 85032074 missense possibly damaging 0.48
R0295:Usp32 UTSW 11 85053692 missense probably damaging 0.98
R1320:Usp32 UTSW 11 85017793 missense probably damaging 0.98
R1712:Usp32 UTSW 11 85042580 missense probably benign 0.12
R1922:Usp32 UTSW 11 85007004 nonsense probably null
R1973:Usp32 UTSW 11 85103931 missense probably benign 0.09
R2010:Usp32 UTSW 11 85040004 missense probably damaging 0.98
R2082:Usp32 UTSW 11 85030512 missense probably damaging 0.99
R2355:Usp32 UTSW 11 85005909 missense probably benign 0.34
R3147:Usp32 UTSW 11 85029087 missense probably damaging 1.00
R3160:Usp32 UTSW 11 85025536 missense probably damaging 0.97
R3162:Usp32 UTSW 11 85025536 missense probably damaging 0.97
R3716:Usp32 UTSW 11 85042563 missense probably damaging 1.00
R3816:Usp32 UTSW 11 84994384 critical splice donor site probably null
R3870:Usp32 UTSW 11 85007055 nonsense probably null
R3871:Usp32 UTSW 11 85081156 missense probably null 0.81
R4041:Usp32 UTSW 11 85017739 missense probably benign 0.40
R4079:Usp32 UTSW 11 85039229 missense probably damaging 0.98
R4332:Usp32 UTSW 11 85103978 missense possibly damaging 0.79
R4396:Usp32 UTSW 11 85053975 missense probably benign
R4580:Usp32 UTSW 11 85059127 critical splice donor site probably null
R4620:Usp32 UTSW 11 85059127 critical splice donor site probably null
R4744:Usp32 UTSW 11 84994393 missense probably damaging 1.00
R4909:Usp32 UTSW 11 85055772 nonsense probably null
R5056:Usp32 UTSW 11 85026795 missense probably benign 0.07
R5111:Usp32 UTSW 11 85077331 missense possibly damaging 0.95
R5213:Usp32 UTSW 11 85022259 missense probably damaging 1.00
R5308:Usp32 UTSW 11 85017718 missense probably benign 0.12
R5381:Usp32 UTSW 11 85059127 critical splice donor site probably benign
R5538:Usp32 UTSW 11 85017786 missense possibly damaging 0.65
R5659:Usp32 UTSW 11 85077414 missense possibly damaging 0.94
R6006:Usp32 UTSW 11 84992451 critical splice donor site probably null
R6011:Usp32 UTSW 11 85032097 missense possibly damaging 0.70
R6029:Usp32 UTSW 11 85025582 missense probably damaging 0.99
R6074:Usp32 UTSW 11 84994573 missense probably benign 0.00
R6331:Usp32 UTSW 11 84986576 missense possibly damaging 0.92
R6353:Usp32 UTSW 11 85022281 missense probably benign
R6714:Usp32 UTSW 11 85026870 missense probably damaging 0.99
R6778:Usp32 UTSW 11 85025686 missense probably benign 0.00
R6988:Usp32 UTSW 11 85010143 missense probably benign 0.35
R6992:Usp32 UTSW 11 85032088 missense probably damaging 0.99
R7182:Usp32 UTSW 11 85040170 missense probably benign 0.34
R7186:Usp32 UTSW 11 85051234 missense probably benign 0.45
R7198:Usp32 UTSW 11 85022855 frame shift probably null
R7201:Usp32 UTSW 11 85022855 frame shift probably null
R7469:Usp32 UTSW 11 84988553 missense possibly damaging 0.94
R7502:Usp32 UTSW 11 85022898 missense possibly damaging 0.48
R7513:Usp32 UTSW 11 85027112 nonsense probably null
R7629:Usp32 UTSW 11 85019855 frame shift probably null
R7703:Usp32 UTSW 11 85077327 missense probably damaging 0.99
R7741:Usp32 UTSW 11 84987281 missense probably damaging 0.99
R7765:Usp32 UTSW 11 84994408 missense probably damaging 1.00
R7933:Usp32 UTSW 11 85007059 missense probably damaging 1.00
R7989:Usp32 UTSW 11 85034300 missense
R7998:Usp32 UTSW 11 84994426 missense probably damaging 1.00
R8292:Usp32 UTSW 11 85077401 missense probably damaging 0.99
R8305:Usp32 UTSW 11 85032185 missense possibly damaging 0.83
R8548:Usp32 UTSW 11 85017827 missense possibly damaging 0.52
R8924:Usp32 UTSW 11 85025544 missense probably damaging 0.98
R9002:Usp32 UTSW 11 85053951 missense probably damaging 0.96
R9145:Usp32 UTSW 11 85022292 missense probably damaging 1.00
R9209:Usp32 UTSW 11 85040012 missense probably damaging 0.98
R9211:Usp32 UTSW 11 85022733 missense probably damaging 1.00
R9296:Usp32 UTSW 11 85017652 missense probably damaging 1.00
R9310:Usp32 UTSW 11 85051202 missense probably benign 0.29
R9417:Usp32 UTSW 11 84994543 missense probably damaging 1.00
R9514:Usp32 UTSW 11 85022734 missense probably damaging 0.99
X0028:Usp32 UTSW 11 84992606 missense probably benign 0.05
Z1177:Usp32 UTSW 11 84988612 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CATGCTGACTTCTCACATTGATG -3'
(R):5'- TTGATAGGCCTGGGACAACC -3'

Sequencing Primer
(F):5'- GCTGACTTCTCACATTGATGAAAAC -3'
(R):5'- AACAAAAGTGTTCTGTGGTTAGAG -3'
Posted On 2020-09-15