Incidental Mutation 'R7973:Kdm1b'
ID 650734
Institutional Source Beutler Lab
Gene Symbol Kdm1b
Ensembl Gene ENSMUSG00000038080
Gene Name lysine (K)-specific demethylase 1B
Synonyms 4632428N09Rik, Aof1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.485) question?
Stock # R7973 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 47043499-47085279 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 47077446 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 650 (S650P)
Ref Sequence ENSEMBL: ENSMUSP00000038373 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037025]
AlphaFold Q8CIG3
Predicted Effect probably benign
Transcript: ENSMUST00000037025
AA Change: S650P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000038373
Gene: ENSMUSG00000038080
AA Change: S650P

DomainStartEndE-ValueType
Pfam:zf-CW 138 191 2.6e-13 PFAM
low complexity region 235 253 N/A INTRINSIC
Pfam:SWIRM 286 369 6e-12 PFAM
Pfam:Pyr_redox_2 368 490 3.1e-8 PFAM
Pfam:Thi4 375 446 2.2e-10 PFAM
Pfam:FAD_binding_3 388 423 4.1e-7 PFAM
Pfam:HI0933_like 389 428 1.6e-7 PFAM
Pfam:FAD_binding_2 390 428 1.6e-6 PFAM
Pfam:Pyr_redox 390 438 8e-8 PFAM
Pfam:NAD_binding_8 393 460 1.6e-13 PFAM
Pfam:Amino_oxidase 398 824 3.7e-86 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000114999
Gene: ENSMUSG00000038080
AA Change: S266P

DomainStartEndE-ValueType
Pfam:SWIRM 3 86 1.1e-12 PFAM
Pfam:Thi4 91 163 3.5e-10 PFAM
Pfam:FAD_binding_3 105 140 3.5e-7 PFAM
Pfam:HI0933_like 106 145 1.7e-7 PFAM
Pfam:Pyr_redox_2 106 251 1.5e-10 PFAM
Pfam:FAD_binding_2 107 150 5.7e-7 PFAM
Pfam:Pyr_redox 107 158 6.4e-8 PFAM
Pfam:Pyr_redox_3 109 288 1.2e-13 PFAM
Pfam:NAD_binding_8 110 177 2.3e-13 PFAM
Pfam:Amino_oxidase 115 181 8.6e-19 PFAM
Pfam:Amino_oxidase 178 441 4.5e-63 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (53/54)
MGI Phenotype PHENOTYPE: Homozygous null mice of both sexes are viable, grossly normal and male mice are fertile; however, heterozygous progeny of homozygous null mothers display severe placental defects, embryonic growth impairment, neural tube defects and pericardial edema, and do not survive past E10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016L21Rik A G 5: 114,946,053 D76G probably benign Het
Abcg1 T C 17: 31,104,158 V237A probably damaging Het
Adgrv1 A T 13: 81,440,225 V4414E possibly damaging Het
Akap11 A T 14: 78,515,066 H122Q Het
Amotl2 C T 9: 102,723,769 T345I probably benign Het
Arhgef4 C T 1: 34,724,437 R925W possibly damaging Het
Arid1a C T 4: 133,753,070 G181D probably damaging Het
Ash1l T A 3: 89,052,857 S2299T probably benign Het
Atf7ip C T 6: 136,561,064 Q432* probably null Het
B430306N03Rik T A 17: 48,316,455 S10T probably benign Het
Bckdk A G 7: 127,906,367 I221V probably benign Het
Brinp2 T C 1: 158,246,487 Y688C probably damaging Het
Caml C T 13: 55,631,971 L286F probably benign Het
Ccdc125 C T 13: 100,669,823 probably benign Het
Cdh24 A T 14: 54,639,020 V116E possibly damaging Het
Cenpe T A 3: 135,223,250 I305N probably damaging Het
Cep41 C T 6: 30,680,131 G33S probably damaging Het
Clec4b2 A T 6: 123,204,189 I178L probably benign Het
Dao AGG AG 5: 114,015,209 probably benign Het
Dapk1 T A 13: 60,761,563 L1330Q probably damaging Het
Evl C T 12: 108,681,524 R295* probably null Het
Fmnl1 G T 11: 103,171,158 probably benign Het
Galk1 A G 11: 116,012,609 F24L possibly damaging Het
Hyal4 T A 6: 24,755,786 M1K probably null Het
Ighe T C 12: 113,273,057 T64A Het
Iqch A G 9: 63,524,946 I389T possibly damaging Het
Ism2 G T 12: 87,286,995 T92K possibly damaging Het
Kctd17 CAGCTGGAGGAGC CAGC 15: 78,436,913 probably benign Het
Mapkapk5 T G 5: 121,525,713 N426T possibly damaging Het
Mroh5 G T 15: 73,792,765 Y90* probably null Het
Ncan T G 8: 70,097,575 I1184L probably benign Het
Nectin3 T C 16: 46,396,121 T439A probably benign Het
Neo1 G T 9: 58,990,193 A160E probably damaging Het
Nosip T C 7: 45,077,360 S295P possibly damaging Het
Nup205 T A 6: 35,245,339 F1979L probably benign Het
Nxpe2 A T 9: 48,319,868 D400E probably damaging Het
Olfr1246 T A 2: 89,590,987 I43F probably damaging Het
Pfkfb4 G A 9: 109,025,111 R351Q probably damaging Het
Psg29 T C 7: 17,210,537 I324T probably benign Het
Ptprh G T 7: 4,580,888 T235N possibly damaging Het
Ralgapa2 T A 2: 146,388,561 N981I possibly damaging Het
Ralgps1 T C 2: 33,146,639 Y421C probably damaging Het
Sf3b3 T C 8: 110,816,290 E845G possibly damaging Het
Sgk1 G T 10: 21,994,155 S31I probably benign Het
Sim1 T G 10: 50,981,323 Y390D probably damaging Het
Slain2 T A 5: 72,955,436 Y271* probably null Het
Slc12a4 G A 8: 105,951,605 R319W possibly damaging Het
St6gal1 G A 16: 23,357,835 A393T probably benign Het
Stab1 A T 14: 31,159,633 probably null Het
Supv3l1 A T 10: 62,449,423 L88Q probably damaging Het
Syt2 C A 1: 134,740,832 probably null Het
Tpr C T 1: 150,403,887 R256C probably damaging Het
Tubg1 G T 11: 101,124,028 A199S probably benign Het
Usp32 A G 11: 85,022,808 I899T probably damaging Het
Usp6nl G T 2: 6,408,951 R96M probably damaging Het
Vmn1r75 A G 7: 11,881,034 D231G probably benign Het
Vmn2r42 T C 7: 8,194,873 E249G probably benign Het
Zbtb34 C T 2: 33,411,519 G337R probably benign Het
Zfp457 T A 13: 67,293,818 H231L probably benign Het
Zfp715 C T 7: 43,299,897 G213D possibly damaging Het
Zfp760 T G 17: 21,722,103 H86Q probably benign Het
Other mutations in Kdm1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00587:Kdm1b APN 13 47068540 missense probably benign 0.01
IGL00924:Kdm1b APN 13 47068480 missense probably benign
IGL01553:Kdm1b APN 13 47080548 missense probably damaging 0.96
IGL01663:Kdm1b APN 13 47073737 missense probably damaging 0.99
IGL02385:Kdm1b APN 13 47068506 missense possibly damaging 0.49
IGL02505:Kdm1b APN 13 47060855 missense probably damaging 1.00
IGL02826:Kdm1b APN 13 47080467 missense probably damaging 1.00
IGL03257:Kdm1b APN 13 47049266 missense probably damaging 1.00
R0052:Kdm1b UTSW 13 47064117 missense probably damaging 1.00
R0319:Kdm1b UTSW 13 47053719 missense probably benign
R0426:Kdm1b UTSW 13 47064244 splice site probably benign
R0599:Kdm1b UTSW 13 47058810 missense possibly damaging 0.47
R0764:Kdm1b UTSW 13 47068603 missense possibly damaging 0.70
R1163:Kdm1b UTSW 13 47071922 missense probably benign 0.02
R1543:Kdm1b UTSW 13 47068521 missense probably damaging 0.99
R1584:Kdm1b UTSW 13 47064054 missense probably damaging 1.00
R1627:Kdm1b UTSW 13 47064231 critical splice donor site probably null
R1669:Kdm1b UTSW 13 47068548 missense probably damaging 1.00
R1758:Kdm1b UTSW 13 47060768 missense probably benign 0.00
R1860:Kdm1b UTSW 13 47049190 missense probably benign 0.03
R1907:Kdm1b UTSW 13 47064120 missense probably benign 0.00
R2225:Kdm1b UTSW 13 47064088 frame shift probably null
R2239:Kdm1b UTSW 13 47073755 missense probably damaging 1.00
R2271:Kdm1b UTSW 13 47064088 frame shift probably null
R2302:Kdm1b UTSW 13 47064088 frame shift probably null
R2303:Kdm1b UTSW 13 47064088 frame shift probably null
R2380:Kdm1b UTSW 13 47073755 missense probably damaging 1.00
R2442:Kdm1b UTSW 13 47062975 missense probably benign 0.32
R3022:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R3054:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R3545:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R3546:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R3548:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R4094:Kdm1b UTSW 13 47063020 missense probably damaging 1.00
R4419:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R4420:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R4502:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R4547:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R4548:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R4785:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R4793:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R4804:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R4882:Kdm1b UTSW 13 47060893 missense probably benign
R4906:Kdm1b UTSW 13 47063144 critical splice donor site probably null
R4965:Kdm1b UTSW 13 47074367 missense probably damaging 0.98
R5039:Kdm1b UTSW 13 47077486 missense probably damaging 1.00
R5098:Kdm1b UTSW 13 47062991 missense probably damaging 1.00
R5265:Kdm1b UTSW 13 47062969 missense probably benign 0.35
R5541:Kdm1b UTSW 13 47079196 missense probably damaging 1.00
R5814:Kdm1b UTSW 13 47063146 splice site probably null
R6046:Kdm1b UTSW 13 47079253 missense possibly damaging 0.92
R6798:Kdm1b UTSW 13 47068536 missense probably benign 0.00
R6903:Kdm1b UTSW 13 47074404 missense probably benign 0.00
R7831:Kdm1b UTSW 13 47050622 missense probably benign 0.17
R8181:Kdm1b UTSW 13 47051901 critical splice donor site probably null
R8248:Kdm1b UTSW 13 47071878 intron probably benign
R8821:Kdm1b UTSW 13 47064141 missense possibly damaging 0.94
R8831:Kdm1b UTSW 13 47064141 missense possibly damaging 0.94
R8842:Kdm1b UTSW 13 47078356 missense probably damaging 1.00
R8861:Kdm1b UTSW 13 47064106 missense probably benign 0.02
R8885:Kdm1b UTSW 13 47053708 nonsense probably null
R9038:Kdm1b UTSW 13 47049294 missense probably benign 0.07
R9132:Kdm1b UTSW 13 47071982 missense probably benign 0.05
R9268:Kdm1b UTSW 13 47064229 missense probably benign 0.00
R9616:Kdm1b UTSW 13 47080554 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTTACGACTGCAAGCAGAGAAG -3'
(R):5'- GACTGAATTGGATATCTGACAGCTC -3'

Sequencing Primer
(F):5'- GAAATAGATAGTCAGGGCTGGTATG -3'
(R):5'- TGGATATCTGACAGCTCATACATG -3'
Posted On 2020-09-15