Mutagenetix > Incidental Mutations

Incidental Mutation 'R0329:Stat4'

65075

Institutional Source

Beutler Lab

Gene Symbol

Stat4

Ensembl Gene

ENSMUSG00000062939

Gene Name

signal transducer and activator of transcription 4

Synonyms

MMRRC Submission

038538-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.445) question?

Stock #

R0329 (G1)

Quality Score

121

Status

Validated

Chromosome

Chromosomal Location

51987148-52107189 bp(+) (GRCm38)

Type of Mutation

intron

DNA Base Change (assembly)

A to G at 52090870 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000130713 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027277] [ENSMUST00000168302]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000027277

SMART Domains

Protein: ENSMUSP00000027277
Gene: ENSMUSG00000062939

Domain	Start	End	E-Value	Type
STAT_int	2	122	3.73e-60	SMART
Pfam:STAT_alpha	140	314	2.2e-54	PFAM
Pfam:STAT_bind	316	562	4.7e-76	PFAM
SH2	571	681	9.07e-1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000105087

SMART Domains

Protein: ENSMUSP00000100711
Gene: ENSMUSG00000078291

Domain	Start	End	E-Value	Type
Pfam:Ribosomal_L23eN	17	54	4.1e-12	PFAM
Pfam:Ribosomal_L23	62	135	9.5e-20	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000168302

SMART Domains

Protein: ENSMUSP00000130713
Gene: ENSMUSG00000062939

Domain	Start	End	E-Value	Type
STAT_int	2	122	3.73e-60	SMART
Pfam:STAT_alpha	137	314	8.2e-66	PFAM
Pfam:STAT_bind	316	563	3.3e-114	PFAM
SH2	571	681	9.07e-1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000185516

Coding Region Coverage

1x: 98.9%
3x: 97.8%
10x: 95.0%
20x: 89.0%

Validation Efficiency

99% (107/108)

MGI Phenotype

FUNCTION: The protein encoded by this gene is a member of the STAT family of transcription factors. In response to cytokines and growth factors, STAT family members are phosphorylated by the receptor associated kinases, and then form homo- or heterodimers that translocate to the cell nucleus where they act as transcription activators. Homozygous knockout mice for this gene exhibit reduced inflammation and cytokine production in response to immune challenge. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygous inactivation of this gene leads to altered cytokine production of T-cells, impaired IL-12 responses, enhanced Th2 cell development, decreased susceptibility to autoimmune diabetes, altered NK cell responses during viral infection, and increased susceptibility to Salmonella infection. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 107 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700061G19Rik	A	T	17: 56,883,631	I400F	probably benign	Het
4833423E24Rik	T	A	2: 85,518,551	R72S	probably benign	Het
4931409K22Rik	T	C	5: 24,545,785		probably null	Het
Abca13	A	T	11: 9,399,430	H3668L	probably damaging	Het
Acvr1c	T	C	2: 58,284,838	T313A	probably damaging	Het
Adam28	T	C	14: 68,617,739	K651R	probably damaging	Het
Adamtsl3	A	T	7: 82,521,990	D417V	probably damaging	Het
Adgrf4	A	T	17: 42,667,313	C380S	probably damaging	Het
AI597479	T	G	1: 43,111,117	L129R	probably benign	Het
Anpep	C	T	7: 79,838,256	E518K	probably benign	Het
Anxa7	A	C	14: 20,469,498		probably null	Het
Arhgap22	A	G	14: 33,369,417	R650G	possibly damaging	Het
Atp8a1	T	A	5: 67,812,073		probably benign	Het
Bcr	C	T	10: 75,181,634	T1209I	possibly damaging	Het
Bmpr1a	C	T	14: 34,429,777	S185N	probably benign	Het
Calcoco1	A	T	15: 102,715,763	M246K	probably benign	Het
Casp12	T	A	9: 5,345,534		probably benign	Het
Ccno	T	A	13: 112,989,996	L333Q	probably damaging	Het
Cdhr2	T	A	13: 54,734,801		probably benign	Het
Cftr	T	A	6: 18,226,097	M318K	probably null	Het
Ckmt2	T	A	13: 91,863,203	D96V	possibly damaging	Het
Cnnm1	C	T	19: 43,441,910	P489L	probably damaging	Het
Cntnap1	A	T	11: 101,188,309	D1175V	probably damaging	Het
Cpne5	A	T	17: 29,211,660	L92H	probably damaging	Het
Crcp	C	A	5: 130,042,242	Q61K	possibly damaging	Het
Dcaf8	T	A	1: 172,187,411	D414E	probably benign	Het
Ddx28	T	C	8: 106,010,245	T394A	probably benign	Het
Ddx55	T	C	5: 124,559,147	F191L	probably benign	Het
Dnaaf1	T	C	8: 119,596,017		probably benign	Het
Dnaaf2	C	A	12: 69,197,744	R181L	probably damaging	Het
Elac2	A	G	11: 64,979,310	Y67C	probably damaging	Het
Elf5	A	G	2: 103,430,420		probably benign	Het
Emcn	T	A	3: 137,416,814		probably benign	Het
Erbb4	T	C	1: 68,298,280		probably benign	Het
Erbin	C	A	13: 103,868,865	C114F	probably damaging	Het
Etfdh	T	C	3: 79,609,844	I353V	probably benign	Het
Fam172a	T	A	13: 77,761,951		probably benign	Het
Fbxl12	C	T	9: 20,638,480	G316D	probably damaging	Het
Gbf1	G	A	19: 46,272,270		probably null	Het
Gbp2b	T	G	3: 142,608,176	S406A	probably benign	Het
Gli3	T	G	13: 15,723,558	L741R	probably damaging	Het
Gmip	G	T	8: 69,810,818	S70I	probably benign	Het
Gnptab	T	C	10: 88,440,309	S1153P	probably damaging	Het
Gp1ba	A	G	11: 70,640,409		probably benign	Het
Gramd1a	T	C	7: 31,138,254	D360G	possibly damaging	Het
Hectd4	T	C	5: 121,259,864	I285T	probably benign	Het
Hrh4	A	G	18: 13,007,245		probably benign	Het
Hsp90b1	T	C	10: 86,694,155	E226G	probably damaging	Het
Hspa13	A	T	16: 75,765,130	D60E	probably damaging	Het
Htt	T	A	5: 34,817,134		probably benign	Het
Ispd	C	T	12: 36,381,838	A22V	possibly damaging	Het
Kif14	G	C	1: 136,496,026		probably benign	Het
Kit	T	G	5: 75,652,829	V888G	probably damaging	Het
Lpin3	T	C	2: 160,905,305	V827A	probably benign	Het
Lrriq4	T	C	3: 30,655,724	S406P	probably benign	Het
Man2c1	T	C	9: 57,141,183	V777A	probably benign	Het
Mcm8	A	G	2: 132,819,994	K83E	possibly damaging	Het
Mep1a	A	G	17: 43,497,898		probably null	Het
Mtor	T	A	4: 148,484,380	V1119E	probably benign	Het
Mybpc2	C	T	7: 44,509,029	A710T	possibly damaging	Het
Myo9a	C	G	9: 59,923,677	T2368S	probably damaging	Het
Nbeal1	A	G	1: 60,268,063	Y1684C	probably damaging	Het
Npm3	A	G	19: 45,749,526	F11L	probably benign	Het
Nutf2	T	A	8: 105,876,363	S37T	probably damaging	Het
Obscn	T	A	11: 59,040,441	I5790F	probably damaging	Het
Obscn	A	T	11: 59,052,506	D4833E	probably damaging	Het
Olfr1015	T	A	2: 85,785,803	C97*	probably null	Het
Olfr123	A	T	17: 37,795,989	M182L	probably benign	Het
Olfr39	T	A	9: 20,285,857	S61T	possibly damaging	Het
Olfr955	T	C	9: 39,470,556	T57A	possibly damaging	Het
Pcdhb1	A	G	18: 37,267,024	D676G	possibly damaging	Het
Pcif1	G	T	2: 164,889,444	R466L	probably damaging	Het
Pdk1	T	C	2: 71,895,674		probably benign	Het
Phxr2	T	C	10: 99,126,117		probably benign	Het
Pidd1	A	T	7: 141,439,561		probably benign	Het
Plec	A	G	15: 76,191,418		probably null	Het
Polr1a	T	A	6: 71,966,416	C1212S	possibly damaging	Het
Pot1a	A	G	6: 25,778,831		probably benign	Het
Prdm5	T	C	6: 65,862,903		probably benign	Het
Primpol	A	T	8: 46,610,461	N53K	probably damaging	Het
Pyroxd1	A	G	6: 142,361,976	I491V	probably benign	Het
Serpinb3b	G	T	1: 107,159,703	N25K	probably damaging	Het
Slc9b1	C	T	3: 135,373,235	R218*	probably null	Het
Ssbp2	T	A	13: 91,680,579		probably null	Het
Steap4	T	C	5: 7,975,829	V130A	possibly damaging	Het
Stoml2	A	G	4: 43,030,238		probably null	Het
Syne2	G	T	12: 75,966,953	G2974C	probably benign	Het
Tfdp2	T	G	9: 96,306,893	F200V	probably damaging	Het
Tgm4	T	C	9: 123,048,557		probably null	Het
Tie1	C	A	4: 118,484,727	R175L	probably benign	Het
Tmem145	A	G	7: 25,308,674		probably benign	Het
Tsacc	A	G	3: 88,282,862	S94P	possibly damaging	Het
Tshz3	T	A	7: 36,770,033	D482E	probably benign	Het
Tspan33	T	C	6: 29,711,092		probably null	Het
Ugt2b35	A	G	5: 87,003,405	K290R	probably null	Het
Unc80	T	C	1: 66,674,087	L2788P	possibly damaging	Het
Usp10	T	A	8: 119,936,557	C39*	probably null	Het
Utp20	T	A	10: 88,817,979	T260S	probably benign	Het
Vmn2r118	G	T	17: 55,610,717	T265K	probably damaging	Het
Vmn2r7	C	A	3: 64,691,018	C797F	probably damaging	Het
Vmn2r98	A	C	17: 19,066,347	H369P	probably benign	Het
Vps39	A	T	2: 120,338,787	Y245N	possibly damaging	Het
Wdr27	A	G	17: 14,934,459		probably benign	Het
Ythdc2	A	G	18: 44,865,060		probably benign	Het
Zcwpw2	C	A	9: 118,014,055		noncoding transcript	Het
Zdhhc1	C	A	8: 105,483,543	A81S	probably benign	Het
Zfp729a	G	T	13: 67,620,354	H585Q	probably damaging	Het

Other mutations in Stat4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00236:Stat4	APN	1	52102878	missense	probably damaging	1.00
IGL00482:Stat4	APN	1	52074697	missense	probably benign	0.05
IGL01395:Stat4	APN	1	52011874	missense	probably damaging	1.00
IGL01533:Stat4	APN	1	52098419	missense	probably damaging	1.00
IGL01943:Stat4	APN	1	52096855	missense	possibly damaging	0.94
IGL02114:Stat4	APN	1	52102865	missense	probably damaging	1.00
IGL02151:Stat4	APN	1	52013870	missense	probably damaging	0.99
IGL02601:Stat4	APN	1	52098415	missense	probably damaging	1.00
R0016:Stat4	UTSW	1	52068780	missense	probably benign	0.01
R0243:Stat4	UTSW	1	52011857	missense	probably benign	0.22
R0973:Stat4	UTSW	1	52096820	missense	probably damaging	0.99
R1144:Stat4	UTSW	1	52084129	splice site	probably benign
R1187:Stat4	UTSW	1	52076677	missense	probably damaging	1.00
R1331:Stat4	UTSW	1	52013927	missense	probably benign	0.20
R1401:Stat4	UTSW	1	52071947	splice site	probably benign
R1529:Stat4	UTSW	1	52011793	missense	probably damaging	1.00
R1711:Stat4	UTSW	1	52106925	missense	probably damaging	1.00
R2213:Stat4	UTSW	1	52013855	missense	probably damaging	0.98
R3003:Stat4	UTSW	1	52102986	missense	probably damaging	1.00
R3683:Stat4	UTSW	1	52013822	missense	possibly damaging	0.89
R3789:Stat4	UTSW	1	52011796	missense	probably benign	0.07
R3919:Stat4	UTSW	1	52096822	missense	possibly damaging	0.62
R4320:Stat4	UTSW	1	52074707	missense	probably benign
R4373:Stat4	UTSW	1	52071941	critical splice donor site	probably null
R5024:Stat4	UTSW	1	52082570	missense	possibly damaging	0.80
R5103:Stat4	UTSW	1	52071895	missense	probably damaging	0.97
R5206:Stat4	UTSW	1	52105236	missense	probably damaging	0.99
R5944:Stat4	UTSW	1	52074739	missense	probably damaging	1.00
R5961:Stat4	UTSW	1	52065384	missense	possibly damaging	0.50
R6001:Stat4	UTSW	1	52096867	missense	probably damaging	0.96
R6161:Stat4	UTSW	1	52074677	missense	possibly damaging	0.94
R6262:Stat4	UTSW	1	52102201	missense	probably null	1.00
R6701:Stat4	UTSW	1	52102974	missense	probably damaging	1.00
R6767:Stat4	UTSW	1	52076583	missense	probably benign	0.00
R6989:Stat4	UTSW	1	52068815	missense	probably benign	0.09
R7507:Stat4	UTSW	1	52078574	missense	probably damaging	1.00
R7539:Stat4	UTSW	1	52071709	splice site	probably null
R7546:Stat4	UTSW	1	52098463	missense	probably damaging	0.98
R7616:Stat4	UTSW	1	52013878	nonsense	probably null
R7751:Stat4	UTSW	1	52082552	missense	possibly damaging	0.73
R8052:Stat4	UTSW	1	52079773	missense	probably damaging	1.00
R8311:Stat4	UTSW	1	52102916	missense	probably damaging	1.00
R8419:Stat4	UTSW	1	52098478	missense	possibly damaging	0.89
R8679:Stat4	UTSW	1	52079832	missense	probably null	1.00
R8699:Stat4	UTSW	1	52071937	missense	probably benign
R8738:Stat4	UTSW	1	52076552	missense	possibly damaging	0.95
R8921:Stat4	UTSW	1	52105733	missense	probably benign	0.39
R9013:Stat4	UTSW	1	52011798	missense	probably benign	0.00
R9237:Stat4	UTSW	1	52106914	missense	probably benign
Z1177:Stat4	UTSW	1	52084099	nonsense	probably null
Z1177:Stat4	UTSW	1	52098485	missense	probably null	1.00

Predicted Primers

PCR Primer
(F):5'- TTGGCAACATCTAGGGCATCATAATCAG -3'
(R):5'- CGAAGAAGGAAGCTCCTGTTCCTC -3'

Sequencing Primer
(F):5'- TCATAATCAGGAGCCAAGCG -3'
(R):5'- TGTTCCTCCCAAAGCTGAAG -3'

Posted On

2013-08-08