Incidental Mutation 'R7974:Ankar'
ID 650751
Institutional Source Beutler Lab
Gene Symbol Ankar
Ensembl Gene ENSMUSG00000039342
Gene Name ankyrin and armadillo repeat containing
Synonyms 4932422E22Rik
MMRRC Submission 046017-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.057) question?
Stock # R7974 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 72682139-72739738 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) C to A at 72738138 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 15 (E15*)
Ref Sequence ENSEMBL: ENSMUSP00000054056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053499] [ENSMUST00000211837] [ENSMUST00000212573] [ENSMUST00000212710]
AlphaFold A2RT91
Predicted Effect probably null
Transcript: ENSMUST00000053499
AA Change: E15*
SMART Domains Protein: ENSMUSP00000054056
Gene: ENSMUSG00000039342
AA Change: E15*

DomainStartEndE-ValueType
low complexity region 46 51 N/A INTRINSIC
low complexity region 484 496 N/A INTRINSIC
ANK 532 561 1.25e2 SMART
ANK 582 611 3.49e0 SMART
ANK 615 644 4.44e2 SMART
ANK 651 680 3.8e-1 SMART
ANK 684 714 9.87e0 SMART
ARM 744 784 5.96e-3 SMART
ARM 785 825 4.09e0 SMART
Blast:ARM 827 865 1e-15 BLAST
ARM 867 907 8.34e0 SMART
ARM 909 949 8.34e0 SMART
Blast:ARM 951 991 2e-13 BLAST
ARM 1034 1077 4.82e1 SMART
ARM 1084 1123 1.3e1 SMART
ARM 1257 1297 6.01e0 SMART
Predicted Effect probably null
Transcript: ENSMUST00000211837
AA Change: E15*
Predicted Effect probably benign
Transcript: ENSMUST00000212573
Predicted Effect probably benign
Transcript: ENSMUST00000212710
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (64/64)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 C T 19: 57,033,405 (GRCm39) probably null Het
Adamts19 A T 18: 59,144,094 (GRCm39) Q892L possibly damaging Het
Adamts9 A G 6: 92,886,668 (GRCm39) probably null Het
Aftph T C 11: 20,648,233 (GRCm39) *686W probably null Het
AI661453 T C 17: 47,777,006 (GRCm39) L244P unknown Het
Ankrd39 A G 1: 36,585,999 (GRCm39) probably benign Het
Arsi A G 18: 61,045,478 (GRCm39) D56G probably damaging Het
Blmh T C 11: 76,856,729 (GRCm39) I245T possibly damaging Het
Ccr6 T C 17: 8,475,056 (GRCm39) F87S probably damaging Het
Cdc42ep2 T C 19: 5,968,523 (GRCm39) K61E probably damaging Het
Celsr1 C T 15: 85,915,231 (GRCm39) G914D probably damaging Het
Cep126 T A 9: 8,120,764 (GRCm39) K86N probably benign Het
Cfap70 A T 14: 20,470,818 (GRCm39) F532I probably damaging Het
Cpsf3 T A 12: 21,358,006 (GRCm39) L506Q probably damaging Het
Dct A C 14: 118,277,067 (GRCm39) I273S probably damaging Het
Dsel T C 1: 111,788,229 (GRCm39) I769V probably benign Het
Dus2 G A 8: 106,762,652 (GRCm39) E138K probably benign Het
Emsy A G 7: 98,279,425 (GRCm39) S305P possibly damaging Het
Erp27 A T 6: 136,885,063 (GRCm39) V245D probably damaging Het
Fez1 C A 9: 36,755,244 (GRCm39) T81K probably damaging Het
Gli3 A C 13: 15,900,841 (GRCm39) Q1409H probably benign Het
Hdac9 T C 12: 34,353,219 (GRCm39) S664G possibly damaging Het
Hibadh A G 6: 52,534,880 (GRCm39) S167P probably benign Het
Hsdl1 A G 8: 120,293,072 (GRCm39) V121A probably benign Het
Ift70a1 T C 2: 75,810,688 (GRCm39) H465R probably damaging Het
Ighv1-18 A C 12: 114,646,669 (GRCm39) I6S possibly damaging Het
Iqcm T A 8: 76,281,520 (GRCm39) M1K probably null Het
Itch T C 2: 155,034,079 (GRCm39) F417S probably damaging Het
Itpr1 C T 6: 108,500,366 (GRCm39) T2653I possibly damaging Het
Kank1 T G 19: 25,401,584 (GRCm39) Y1064D probably damaging Het
Kmt2c T C 5: 25,505,561 (GRCm39) Q3249R probably damaging Het
Lefty1 T C 1: 180,765,385 (GRCm39) C318R probably damaging Het
Lmbr1l C T 15: 98,809,500 (GRCm39) V147I probably benign Het
Meig1 C A 2: 3,412,911 (GRCm39) E37* probably null Het
Mpp3 A G 11: 101,899,180 (GRCm39) probably null Het
Muc17 T C 5: 137,175,664 (GRCm39) N2S Het
Mup7 T C 4: 60,067,518 (GRCm39) E199G possibly damaging Het
Nol4 G C 18: 22,852,082 (GRCm39) Y275* probably null Het
Nrxn1 G A 17: 91,008,207 (GRCm39) P429S probably damaging Het
Or14j8 T C 17: 38,263,672 (GRCm39) Y81C probably damaging Het
Pfkl A T 10: 77,829,996 (GRCm39) F367L probably damaging Het
Pik3cg T C 12: 32,254,031 (GRCm39) E652G probably benign Het
Prkag3 A G 1: 74,783,980 (GRCm39) I301T probably benign Het
Rcn1 G A 2: 105,224,055 (GRCm39) P163L probably benign Het
Slc1a7 G A 4: 107,869,473 (GRCm39) V513M probably benign Het
Slc37a2 A T 9: 37,150,421 (GRCm39) probably null Het
Slc9b1 C T 3: 135,099,791 (GRCm39) T437I possibly damaging Het
Smap1 T G 1: 23,888,522 (GRCm39) T248P probably benign Het
Smpd3 A C 8: 106,982,254 (GRCm39) C617G probably benign Het
Spata20 T C 11: 94,374,966 (GRCm39) N212S possibly damaging Het
Sphkap A C 1: 83,256,683 (GRCm39) C355W probably damaging Het
Spopfm2 T C 3: 94,082,848 (GRCm39) K321R probably benign Het
Spsb1 T A 4: 149,991,566 (GRCm39) M1L probably damaging Het
Srebf2 C T 15: 82,062,966 (GRCm39) R468C probably damaging Het
Stxbp5 A C 10: 9,646,439 (GRCm39) probably null Het
Taar5 G C 10: 23,847,120 (GRCm39) D173H possibly damaging Het
Tfrc A G 16: 32,440,101 (GRCm39) D438G probably null Het
Tinag A T 9: 76,907,131 (GRCm39) I368K probably benign Het
Tm9sf1 A G 14: 55,873,906 (GRCm39) W531R probably damaging Het
Tnc G T 4: 63,918,961 (GRCm39) P1154Q possibly damaging Het
Toporsl A G 4: 52,611,645 (GRCm39) R513G probably damaging Het
Vat1 A G 11: 101,356,956 (GRCm39) S2P probably benign Het
Vmn2r107 C G 17: 20,577,270 (GRCm39) P423A probably benign Het
Vmn2r2 T A 3: 64,024,808 (GRCm39) E591V probably damaging Het
Vmn2r62 T A 7: 42,437,281 (GRCm39) Y401F probably damaging Het
Vmn2r62 G A 7: 42,414,031 (GRCm39) T804I probably damaging Het
Vmn2r89 A T 14: 51,693,459 (GRCm39) I270F probably damaging Het
Zfp418 T C 7: 7,185,167 (GRCm39) F377L possibly damaging Het
Zkscan5 T C 5: 145,144,502 (GRCm39) S182P unknown Het
Other mutations in Ankar
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Ankar APN 1 72,729,290 (GRCm39) missense probably damaging 1.00
IGL01013:Ankar APN 1 72,690,148 (GRCm39) missense possibly damaging 0.90
IGL01135:Ankar APN 1 72,704,378 (GRCm39) missense probably benign 0.28
IGL01824:Ankar APN 1 72,690,886 (GRCm39) missense probably benign 0.40
IGL01885:Ankar APN 1 72,697,862 (GRCm39) missense probably damaging 1.00
IGL01932:Ankar APN 1 72,738,146 (GRCm39) missense probably benign 0.25
IGL02143:Ankar APN 1 72,697,808 (GRCm39) critical splice donor site probably null
IGL02326:Ankar APN 1 72,705,514 (GRCm39) missense probably damaging 1.00
IGL02445:Ankar APN 1 72,705,524 (GRCm39) missense probably benign 0.05
IGL02606:Ankar APN 1 72,729,444 (GRCm39) missense possibly damaging 0.61
IGL02635:Ankar APN 1 72,691,590 (GRCm39) missense possibly damaging 0.93
IGL02680:Ankar APN 1 72,709,275 (GRCm39) missense probably damaging 1.00
IGL02704:Ankar APN 1 72,691,502 (GRCm39) missense possibly damaging 0.88
IGL03086:Ankar APN 1 72,682,437 (GRCm39) missense possibly damaging 0.84
IGL03269:Ankar APN 1 72,704,360 (GRCm39) missense probably damaging 0.99
IGL03368:Ankar APN 1 72,714,972 (GRCm39) missense probably damaging 1.00
R0050:Ankar UTSW 1 72,695,323 (GRCm39) missense probably damaging 1.00
R0050:Ankar UTSW 1 72,695,323 (GRCm39) missense probably damaging 1.00
R0488:Ankar UTSW 1 72,697,891 (GRCm39) missense probably damaging 1.00
R0650:Ankar UTSW 1 72,695,380 (GRCm39) splice site probably benign
R1121:Ankar UTSW 1 72,690,822 (GRCm39) splice site probably null
R1163:Ankar UTSW 1 72,727,864 (GRCm39) missense possibly damaging 0.82
R1300:Ankar UTSW 1 72,682,323 (GRCm39) missense probably benign 0.00
R1309:Ankar UTSW 1 72,713,163 (GRCm39) missense possibly damaging 0.59
R1366:Ankar UTSW 1 72,737,808 (GRCm39) missense probably damaging 1.00
R1456:Ankar UTSW 1 72,704,277 (GRCm39) missense probably benign 0.34
R1495:Ankar UTSW 1 72,682,450 (GRCm39) missense probably benign
R1583:Ankar UTSW 1 72,718,714 (GRCm39) splice site probably benign
R1635:Ankar UTSW 1 72,689,297 (GRCm39) missense probably damaging 0.99
R1975:Ankar UTSW 1 72,697,600 (GRCm39) missense possibly damaging 0.95
R2036:Ankar UTSW 1 72,705,689 (GRCm39) nonsense probably null
R2511:Ankar UTSW 1 72,697,853 (GRCm39) missense probably damaging 1.00
R2965:Ankar UTSW 1 72,714,979 (GRCm39) missense probably benign 0.00
R3404:Ankar UTSW 1 72,682,252 (GRCm39) nonsense probably null
R3417:Ankar UTSW 1 72,698,135 (GRCm39) critical splice donor site probably null
R4072:Ankar UTSW 1 72,727,751 (GRCm39) missense probably damaging 1.00
R4231:Ankar UTSW 1 72,697,701 (GRCm39) missense probably benign 0.23
R4447:Ankar UTSW 1 72,726,948 (GRCm39) missense possibly damaging 0.60
R4632:Ankar UTSW 1 72,686,343 (GRCm39) missense probably benign 0.01
R4720:Ankar UTSW 1 72,738,170 (GRCm39) missense possibly damaging 0.55
R4754:Ankar UTSW 1 72,737,853 (GRCm39) missense probably damaging 1.00
R4884:Ankar UTSW 1 72,737,966 (GRCm39) missense probably damaging 0.97
R5068:Ankar UTSW 1 72,719,369 (GRCm39) splice site probably null
R5069:Ankar UTSW 1 72,719,369 (GRCm39) splice site probably null
R5070:Ankar UTSW 1 72,719,369 (GRCm39) splice site probably null
R5189:Ankar UTSW 1 72,697,573 (GRCm39) missense probably benign 0.01
R5247:Ankar UTSW 1 72,719,343 (GRCm39) missense probably benign 0.08
R5322:Ankar UTSW 1 72,729,545 (GRCm39) splice site probably null
R5345:Ankar UTSW 1 72,709,310 (GRCm39) missense possibly damaging 0.94
R5864:Ankar UTSW 1 72,698,324 (GRCm39) missense probably benign 0.00
R5976:Ankar UTSW 1 72,682,450 (GRCm39) missense probably benign
R6003:Ankar UTSW 1 72,738,046 (GRCm39) missense probably damaging 1.00
R6042:Ankar UTSW 1 72,713,213 (GRCm39) nonsense probably null
R6296:Ankar UTSW 1 72,682,417 (GRCm39) missense probably damaging 1.00
R6488:Ankar UTSW 1 72,720,967 (GRCm39) critical splice donor site probably null
R6885:Ankar UTSW 1 72,682,195 (GRCm39) missense unknown
R6985:Ankar UTSW 1 72,697,641 (GRCm39) missense probably damaging 1.00
R7060:Ankar UTSW 1 72,695,272 (GRCm39) missense probably benign 0.18
R7099:Ankar UTSW 1 72,682,452 (GRCm39) missense probably damaging 0.99
R7194:Ankar UTSW 1 72,698,192 (GRCm39) missense probably benign 0.32
R7221:Ankar UTSW 1 72,689,390 (GRCm39) missense probably damaging 1.00
R7222:Ankar UTSW 1 72,705,514 (GRCm39) missense probably damaging 0.99
R7258:Ankar UTSW 1 72,690,886 (GRCm39) missense probably benign 0.40
R7303:Ankar UTSW 1 72,698,192 (GRCm39) missense probably benign 0.32
R7308:Ankar UTSW 1 72,690,953 (GRCm39) nonsense probably null
R7384:Ankar UTSW 1 72,697,624 (GRCm39) missense probably benign 0.00
R7424:Ankar UTSW 1 72,719,217 (GRCm39) missense probably damaging 1.00
R7464:Ankar UTSW 1 72,738,053 (GRCm39) missense possibly damaging 0.94
R7525:Ankar UTSW 1 72,727,800 (GRCm39) missense probably benign 0.18
R7618:Ankar UTSW 1 72,714,925 (GRCm39) missense probably benign 0.22
R7659:Ankar UTSW 1 72,729,294 (GRCm39) missense possibly damaging 0.95
R8008:Ankar UTSW 1 72,705,643 (GRCm39) missense possibly damaging 0.47
R8119:Ankar UTSW 1 72,686,160 (GRCm39) missense probably damaging 0.98
R8244:Ankar UTSW 1 72,690,183 (GRCm39) missense probably benign
R8342:Ankar UTSW 1 72,691,619 (GRCm39) missense probably damaging 1.00
R8494:Ankar UTSW 1 72,697,953 (GRCm39) missense probably benign 0.16
R8851:Ankar UTSW 1 72,691,535 (GRCm39) missense probably damaging 1.00
R8970:Ankar UTSW 1 72,691,496 (GRCm39) critical splice donor site probably null
R9228:Ankar UTSW 1 72,713,210 (GRCm39) missense probably benign 0.27
R9511:Ankar UTSW 1 72,719,161 (GRCm39) missense probably benign 0.23
R9577:Ankar UTSW 1 72,721,067 (GRCm39) missense probably benign 0.02
R9612:Ankar UTSW 1 72,704,294 (GRCm39) missense possibly damaging 0.65
R9647:Ankar UTSW 1 72,689,307 (GRCm39) missense probably damaging 1.00
R9803:Ankar UTSW 1 72,698,340 (GRCm39) missense possibly damaging 0.47
Z1176:Ankar UTSW 1 72,729,120 (GRCm39) missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TCTACAGGAGTCAGTAGGATGG -3'
(R):5'- CTGTCCATGAAAAGATTAGCTTGC -3'

Sequencing Primer
(F):5'- CAGTGGAGAAGCCTGCATTATTC -3'
(R):5'- CCATGAAAAGATTAGCTTGCTTTAG -3'
Posted On 2020-09-15