Mutagenetix > Incidental Mutation

Incidental Mutation 'R7974:Sphkap'

650753

Institutional Source

Beutler Lab

Gene Symbol

Sphkap

Ensembl Gene

ENSMUSG00000026163

Gene Name

SPHK1 interactor, AKAP domain containing

Synonyms

4930544G21Rik, A930009L15Rik, SKIP

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.064) question?

Stock #

R7974 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

83254139-83408200 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 83278962 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Tryptophan at position 355 (C355W)

Ref Sequence

ENSEMBL: ENSMUSP00000124872 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000159078] [ENSMUST00000160953]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000159078
AA Change: C68W

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000124384
Gene: ENSMUSG00000026163
AA Change: C68W

Domain	Start	End	E-Value	Type
low complexity region	303	314	N/A	INTRINSIC
SCOP:d1ash__	382	462	5e-3	SMART
low complexity region	809	819	N/A	INTRINSIC
low complexity region	854	865	N/A	INTRINSIC
low complexity region	1202	1221	N/A	INTRINSIC
low complexity region	1243	1254	N/A	INTRINSIC
Pfam:AKAP_110	1281	1398	7.5e-13	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000160953
AA Change: C355W

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000124872
Gene: ENSMUSG00000026163
AA Change: C355W

Domain	Start	End	E-Value	Type
low complexity region	590	601	N/A	INTRINSIC
SCOP:d1ash__	669	749	6e-3	SMART
low complexity region	1096	1106	N/A	INTRINSIC
low complexity region	1141	1152	N/A	INTRINSIC
low complexity region	1489	1508	N/A	INTRINSIC
Pfam:AKAP_110	1540	1655	6.4e-12	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (64/64)

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ablim1	C	T	19: 57,044,973		probably null	Het
Adamts19	A	T	18: 59,011,022	Q892L	possibly damaging	Het
Adamts9	A	G	6: 92,909,687		probably null	Het
Aftph	T	C	11: 20,698,233	*686W	probably null	Het
AI661453	T	C	17: 47,466,081	L244P	unknown	Het
Ankar	C	A	1: 72,698,979	E15*	probably null	Het
Ankrd39	A	G	1: 36,546,918		probably benign	Het
Arsi	A	G	18: 60,912,406	D56G	probably damaging	Het
Blmh	T	C	11: 76,965,903	I245T	possibly damaging	Het
Ccr6	T	C	17: 8,256,224	F87S	probably damaging	Het
Cdc42ep2	T	C	19: 5,918,495	K61E	probably damaging	Het
Celsr1	C	T	15: 86,031,030	G914D	probably damaging	Het
Cep126	T	A	9: 8,120,763	K86N	probably benign	Het
Cfap70	A	T	14: 20,420,750	F532I	probably damaging	Het
Cpsf3	T	A	12: 21,308,005	L506Q	probably damaging	Het
Dct	A	C	14: 118,039,655	I273S	probably damaging	Het
Dsel	T	C	1: 111,860,499	I769V	probably benign	Het
Dus2	G	A	8: 106,036,020	E138K	probably benign	Het
Emsy	A	G	7: 98,630,218	S305P	possibly damaging	Het
Erp27	A	T	6: 136,908,065	V245D	probably damaging	Het
Fez1	C	A	9: 36,843,948	T81K	probably damaging	Het
Gli3	A	C	13: 15,726,256	Q1409H	probably benign	Het
Gm10696	T	C	3: 94,175,541	K321R	probably benign	Het
Hdac9	T	C	12: 34,303,220	S664G	possibly damaging	Het
Hibadh	A	G	6: 52,557,895	S167P	probably benign	Het
Hsdl1	A	G	8: 119,566,333	V121A	probably benign	Het
Ighv1-18	A	C	12: 114,683,049	I6S	possibly damaging	Het
Iqcm	T	A	8: 75,554,892	M1K	probably null	Het
Itch	T	C	2: 155,192,159	F417S	probably damaging	Het
Itpr1	C	T	6: 108,523,405	T2653I	possibly damaging	Het
Kank1	T	G	19: 25,424,220	Y1064D	probably damaging	Het
Kmt2c	T	C	5: 25,300,563	Q3249R	probably damaging	Het
Lefty1	T	C	1: 180,937,820	C318R	probably damaging	Het
Lmbr1l	C	T	15: 98,911,619	V147I	probably benign	Het
Meig1	C	A	2: 3,411,874	E37*	probably null	Het
Mpp3	A	G	11: 102,008,354		probably null	Het
Muc3	T	C	5: 137,146,816	N2S		Het
Mup7	T	C	4: 60,067,518	E199G	possibly damaging	Het
Nol4	G	C	18: 22,719,025	Y275*	probably null	Het
Nrxn1	G	A	17: 90,700,779	P429S	probably damaging	Het
Olfr761	T	C	17: 37,952,781	Y81C	probably damaging	Het
Pfkl	A	T	10: 77,994,162	F367L	probably damaging	Het
Pik3cg	T	C	12: 32,204,032	E652G	probably benign	Het
Prkag3	A	G	1: 74,744,821	I301T	probably benign	Het
Rcn1	G	A	2: 105,393,710	P163L	probably benign	Het
Slc1a7	G	A	4: 108,012,276	V513M	probably benign	Het
Slc37a2	A	T	9: 37,239,125		probably null	Het
Slc9b1	C	T	3: 135,394,030	T437I	possibly damaging	Het
Smap1	T	G	1: 23,849,441	T248P	probably benign	Het
Smpd3	A	C	8: 106,255,622	C617G	probably benign	Het
Spata20	T	C	11: 94,484,140	N212S	possibly damaging	Het
Spsb1	T	A	4: 149,907,109	M1L	probably damaging	Het
Srebf2	C	T	15: 82,178,765	R468C	probably damaging	Het
Stxbp5	A	C	10: 9,770,695		probably null	Het
Taar5	G	C	10: 23,971,222	D173H	possibly damaging	Het
Tfrc	A	G	16: 32,621,283	D438G	probably null	Het
Tinag	A	T	9: 76,999,849	I368K	probably benign	Het
Tm9sf1	A	G	14: 55,636,449	W531R	probably damaging	Het
Tnc	G	T	4: 64,000,724	P1154Q	possibly damaging	Het
Toporsl	A	G	4: 52,611,645	R513G	probably damaging	Het
Ttc30a1	T	C	2: 75,980,344	H465R	probably damaging	Het
Vat1	A	G	11: 101,466,130	S2P	probably benign	Het
Vmn2r107	C	G	17: 20,357,008	P423A	probably benign	Het
Vmn2r2	T	A	3: 64,117,387	E591V	probably damaging	Het
Vmn2r62	G	A	7: 42,764,607	T804I	probably damaging	Het
Vmn2r62	T	A	7: 42,787,857	Y401F	probably damaging	Het
Vmn2r89	A	T	14: 51,456,002	I270F	probably damaging	Het
Zfp418	T	C	7: 7,182,168	F377L	possibly damaging	Het
Zkscan5	T	C	5: 145,207,692	S182P	unknown	Het

Other mutations in Sphkap

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00332:Sphkap	APN	1	83280516	missense	probably damaging	1.00
IGL00337:Sphkap	APN	1	83339608	missense	probably damaging	1.00
IGL00470:Sphkap	APN	1	83277910	missense	possibly damaging	0.87
IGL00577:Sphkap	APN	1	83278844	missense	probably damaging	1.00
IGL00657:Sphkap	APN	1	83276375	missense	probably damaging	1.00
IGL01868:Sphkap	APN	1	83280399	splice site	probably null
IGL02101:Sphkap	APN	1	83290987	missense	probably damaging	1.00
IGL02471:Sphkap	APN	1	83276176	missense	probably damaging	1.00
IGL02943:Sphkap	APN	1	83276831	missense	probably damaging	1.00
IGL02945:Sphkap	APN	1	83276831	missense	probably damaging	1.00
IGL03008:Sphkap	APN	1	83276831	missense	probably damaging	1.00
IGL03031:Sphkap	APN	1	83276831	missense	probably damaging	1.00
IGL03059:Sphkap	APN	1	83257242	missense	probably damaging	0.97
IGL03085:Sphkap	APN	1	83280354	missense	possibly damaging	0.92
IGL03355:Sphkap	APN	1	83280503	missense	probably damaging	1.00
IGL03356:Sphkap	APN	1	83276831	missense	probably damaging	1.00
IGL03368:Sphkap	APN	1	83275676	missense	probably benign	0.14
R0294:Sphkap	UTSW	1	83278245	missense	possibly damaging	0.72
R0308:Sphkap	UTSW	1	83276969	missense	probably damaging	1.00
R0478:Sphkap	UTSW	1	83278711	missense	probably damaging	1.00
R0606:Sphkap	UTSW	1	83280424	missense	probably damaging	1.00
R0678:Sphkap	UTSW	1	83278628	missense	probably benign	0.03
R1216:Sphkap	UTSW	1	83290977	missense	probably damaging	1.00
R1253:Sphkap	UTSW	1	83278898	missense	possibly damaging	0.56
R1532:Sphkap	UTSW	1	83257203	missense	probably damaging	1.00
R1635:Sphkap	UTSW	1	83278400	missense	probably benign	0.03
R1655:Sphkap	UTSW	1	83277515	nonsense	probably null
R1657:Sphkap	UTSW	1	83277515	nonsense	probably null
R1700:Sphkap	UTSW	1	83277515	nonsense	probably null
R1701:Sphkap	UTSW	1	83277515	nonsense	probably null
R1734:Sphkap	UTSW	1	83277515	nonsense	probably null
R1736:Sphkap	UTSW	1	83277515	nonsense	probably null
R1743:Sphkap	UTSW	1	83277515	nonsense	probably null
R1744:Sphkap	UTSW	1	83277515	nonsense	probably null
R1760:Sphkap	UTSW	1	83277544	missense	probably benign	0.29
R1893:Sphkap	UTSW	1	83278966	missense	probably benign	0.02
R1937:Sphkap	UTSW	1	83267441	nonsense	probably null
R1986:Sphkap	UTSW	1	83277922	missense	probably damaging	1.00
R1993:Sphkap	UTSW	1	83277515	nonsense	probably null
R1995:Sphkap	UTSW	1	83277515	nonsense	probably null
R2001:Sphkap	UTSW	1	83276662	missense	probably damaging	1.00
R2004:Sphkap	UTSW	1	83277911	missense	probably benign	0.04
R2111:Sphkap	UTSW	1	83275881	missense	probably benign	0.00
R2112:Sphkap	UTSW	1	83275881	missense	probably benign	0.00
R2156:Sphkap	UTSW	1	83277989	missense	probably benign	0.03
R2182:Sphkap	UTSW	1	83276684	missense	probably damaging	1.00
R2271:Sphkap	UTSW	1	83257221	missense	probably damaging	1.00
R3712:Sphkap	UTSW	1	83277112	missense	probably benign	0.27
R3919:Sphkap	UTSW	1	83276458	missense	probably damaging	1.00
R3980:Sphkap	UTSW	1	83267494	splice site	probably null
R4130:Sphkap	UTSW	1	83277898	missense	probably damaging	0.96
R4539:Sphkap	UTSW	1	83277793	missense	probably benign	0.00
R4602:Sphkap	UTSW	1	83279061	nonsense	probably null
R4735:Sphkap	UTSW	1	83279117	missense	probably benign	0.01
R4793:Sphkap	UTSW	1	83278084	missense	possibly damaging	0.77
R4849:Sphkap	UTSW	1	83277384	missense	probably benign	0.03
R4880:Sphkap	UTSW	1	83288817	missense	probably damaging	1.00
R5213:Sphkap	UTSW	1	83280503	missense	probably damaging	1.00
R5277:Sphkap	UTSW	1	83276164	missense	probably benign	0.04
R5331:Sphkap	UTSW	1	83276782	missense	probably benign	0.08
R5632:Sphkap	UTSW	1	83278285	missense	probably benign	0.01
R5647:Sphkap	UTSW	1	83407999	missense	probably damaging	0.98
R5751:Sphkap	UTSW	1	83275897	missense	probably benign	0.27
R5935:Sphkap	UTSW	1	83339599	missense	probably damaging	1.00
R5999:Sphkap	UTSW	1	83267405	missense	probably benign	0.02
R6232:Sphkap	UTSW	1	83280479	missense	probably damaging	1.00
R6318:Sphkap	UTSW	1	83278378	missense	probably damaging	1.00
R6474:Sphkap	UTSW	1	83278823	missense	probably damaging	1.00
R6602:Sphkap	UTSW	1	83275758	missense	possibly damaging	0.75
R6674:Sphkap	UTSW	1	83277834	missense	probably benign	0.37
R6716:Sphkap	UTSW	1	83362228	critical splice donor site	probably null
R6803:Sphkap	UTSW	1	83280510	missense	probably damaging	1.00
R6880:Sphkap	UTSW	1	83257257	missense	probably damaging	1.00
R6941:Sphkap	UTSW	1	83408090	start gained	probably benign
R7170:Sphkap	UTSW	1	83265985	missense	probably damaging	0.99
R7263:Sphkap	UTSW	1	83276678	missense	probably damaging	1.00
R7422:Sphkap	UTSW	1	83263826	missense	probably benign	0.02
R7640:Sphkap	UTSW	1	83278928	missense	possibly damaging	0.94
R7722:Sphkap	UTSW	1	83278921	missense	probably benign	0.00
R7810:Sphkap	UTSW	1	83276300	missense	probably damaging	1.00
R7887:Sphkap	UTSW	1	83277412	missense	probably benign	0.00
R7990:Sphkap	UTSW	1	83267345	missense	probably damaging	0.99
R8096:Sphkap	UTSW	1	83277558	missense	probably damaging	0.98
R8110:Sphkap	UTSW	1	83278771	missense	possibly damaging	0.82
R8125:Sphkap	UTSW	1	83263582	missense	probably damaging	1.00
R8153:Sphkap	UTSW	1	83278009	missense	possibly damaging	0.93
R8245:Sphkap	UTSW	1	83278771	missense	probably benign	0.14
R8394:Sphkap	UTSW	1	83276076	missense	probably benign	0.08
R8443:Sphkap	UTSW	1	83278232	missense	probably benign	0.00
R8508:Sphkap	UTSW	1	83276500	missense	probably damaging	1.00
R8531:Sphkap	UTSW	1	83277188	missense	probably damaging	1.00
R8673:Sphkap	UTSW	1	83275840	missense	probably benign	0.01
R8674:Sphkap	UTSW	1	83277844	missense	probably benign	0.04
R8682:Sphkap	UTSW	1	83279276	missense	probably benign	0.21
R8837:Sphkap	UTSW	1	83275663	missense	possibly damaging	0.87
R8857:Sphkap	UTSW	1	83280567	missense	probably damaging	1.00
R8902:Sphkap	UTSW	1	83278964	missense	probably benign	0.21
R8916:Sphkap	UTSW	1	83277387	missense	possibly damaging	0.87
R8944:Sphkap	UTSW	1	83279206	missense	probably benign	0.39
R9154:Sphkap	UTSW	1	83257261	missense	probably damaging	1.00
R9579:Sphkap	UTSW	1	83277574	missense	probably damaging	0.99
R9616:Sphkap	UTSW	1	83277268	missense	probably damaging	1.00
R9781:Sphkap	UTSW	1	83278051	missense	possibly damaging	0.62
Z1088:Sphkap	UTSW	1	83276608	missense	probably damaging	1.00
Z1088:Sphkap	UTSW	1	83278604	missense	probably damaging	1.00
Z1176:Sphkap	UTSW	1	83276033	nonsense	probably null
Z1176:Sphkap	UTSW	1	83280442	missense	possibly damaging	0.61
Z1177:Sphkap	UTSW	1	83276431	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- TTTGTGCAACAGCCACTGGG -3'
(R):5'- CGTTTAGTCAGGCCATCACAC -3'

Sequencing Primer
(F):5'- AACTGACTGCAGATTCCTGG -3'
(R):5'- CCATCACACCTGAAAAGTGAAGTGG -3'

Posted On

2020-09-15