Incidental Mutation 'R7974:Rcn1'
ID 650758
Institutional Source Beutler Lab
Gene Symbol Rcn1
Ensembl Gene ENSMUSG00000005973
Gene Name reticulocalbin 1
Synonyms Rcn
MMRRC Submission 046017-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7974 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 105216636-105229664 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 105224055 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Leucine at position 163 (P163L)
Ref Sequence ENSEMBL: ENSMUSP00000006128 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006128]
AlphaFold Q05186
Predicted Effect probably benign
Transcript: ENSMUST00000006128
AA Change: P163L

PolyPhen 2 Score 0.320 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000006128
Gene: ENSMUSG00000005973
AA Change: P163L

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EFh 77 105 1.45e0 SMART
EFh 113 141 6.56e0 SMART
Blast:EFh 164 192 3e-9 BLAST
EFh 201 229 4.35e-2 SMART
Pfam:EF-hand_5 244 267 1.6e-4 PFAM
Blast:EFh 278 306 2e-9 BLAST
Meta Mutation Damage Score 0.1775 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Reticulocalbin 1 is a calcium-binding protein located in the lumen of the ER. The protein contains six conserved regions with similarity to a high affinity Ca(+2)-binding motif, the EF-hand. High conservation of amino acid residues outside of these motifs, in comparison to mouse reticulocalbin, is consistent with a possible biochemical function besides that of calcium binding. In human endothelial and prostate cancer cell lines this protein localizes to the plasma membrane.[provided by RefSeq, Jan 2009]
Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 C T 19: 57,033,405 (GRCm39) probably null Het
Adamts19 A T 18: 59,144,094 (GRCm39) Q892L possibly damaging Het
Adamts9 A G 6: 92,886,668 (GRCm39) probably null Het
Aftph T C 11: 20,648,233 (GRCm39) *686W probably null Het
AI661453 T C 17: 47,777,006 (GRCm39) L244P unknown Het
Ankar C A 1: 72,738,138 (GRCm39) E15* probably null Het
Ankrd39 A G 1: 36,585,999 (GRCm39) probably benign Het
Arsi A G 18: 61,045,478 (GRCm39) D56G probably damaging Het
Blmh T C 11: 76,856,729 (GRCm39) I245T possibly damaging Het
Ccr6 T C 17: 8,475,056 (GRCm39) F87S probably damaging Het
Cdc42ep2 T C 19: 5,968,523 (GRCm39) K61E probably damaging Het
Celsr1 C T 15: 85,915,231 (GRCm39) G914D probably damaging Het
Cep126 T A 9: 8,120,764 (GRCm39) K86N probably benign Het
Cfap70 A T 14: 20,470,818 (GRCm39) F532I probably damaging Het
Cpsf3 T A 12: 21,358,006 (GRCm39) L506Q probably damaging Het
Dct A C 14: 118,277,067 (GRCm39) I273S probably damaging Het
Dsel T C 1: 111,788,229 (GRCm39) I769V probably benign Het
Dus2 G A 8: 106,762,652 (GRCm39) E138K probably benign Het
Emsy A G 7: 98,279,425 (GRCm39) S305P possibly damaging Het
Erp27 A T 6: 136,885,063 (GRCm39) V245D probably damaging Het
Fez1 C A 9: 36,755,244 (GRCm39) T81K probably damaging Het
Gli3 A C 13: 15,900,841 (GRCm39) Q1409H probably benign Het
Hdac9 T C 12: 34,353,219 (GRCm39) S664G possibly damaging Het
Hibadh A G 6: 52,534,880 (GRCm39) S167P probably benign Het
Hsdl1 A G 8: 120,293,072 (GRCm39) V121A probably benign Het
Ift70a1 T C 2: 75,810,688 (GRCm39) H465R probably damaging Het
Ighv1-18 A C 12: 114,646,669 (GRCm39) I6S possibly damaging Het
Iqcm T A 8: 76,281,520 (GRCm39) M1K probably null Het
Itch T C 2: 155,034,079 (GRCm39) F417S probably damaging Het
Itpr1 C T 6: 108,500,366 (GRCm39) T2653I possibly damaging Het
Kank1 T G 19: 25,401,584 (GRCm39) Y1064D probably damaging Het
Kmt2c T C 5: 25,505,561 (GRCm39) Q3249R probably damaging Het
Lefty1 T C 1: 180,765,385 (GRCm39) C318R probably damaging Het
Lmbr1l C T 15: 98,809,500 (GRCm39) V147I probably benign Het
Meig1 C A 2: 3,412,911 (GRCm39) E37* probably null Het
Mpp3 A G 11: 101,899,180 (GRCm39) probably null Het
Muc17 T C 5: 137,175,664 (GRCm39) N2S Het
Mup7 T C 4: 60,067,518 (GRCm39) E199G possibly damaging Het
Nol4 G C 18: 22,852,082 (GRCm39) Y275* probably null Het
Nrxn1 G A 17: 91,008,207 (GRCm39) P429S probably damaging Het
Or14j8 T C 17: 38,263,672 (GRCm39) Y81C probably damaging Het
Pfkl A T 10: 77,829,996 (GRCm39) F367L probably damaging Het
Pik3cg T C 12: 32,254,031 (GRCm39) E652G probably benign Het
Prkag3 A G 1: 74,783,980 (GRCm39) I301T probably benign Het
Slc1a7 G A 4: 107,869,473 (GRCm39) V513M probably benign Het
Slc37a2 A T 9: 37,150,421 (GRCm39) probably null Het
Slc9b1 C T 3: 135,099,791 (GRCm39) T437I possibly damaging Het
Smap1 T G 1: 23,888,522 (GRCm39) T248P probably benign Het
Smpd3 A C 8: 106,982,254 (GRCm39) C617G probably benign Het
Spata20 T C 11: 94,374,966 (GRCm39) N212S possibly damaging Het
Sphkap A C 1: 83,256,683 (GRCm39) C355W probably damaging Het
Spopfm2 T C 3: 94,082,848 (GRCm39) K321R probably benign Het
Spsb1 T A 4: 149,991,566 (GRCm39) M1L probably damaging Het
Srebf2 C T 15: 82,062,966 (GRCm39) R468C probably damaging Het
Stxbp5 A C 10: 9,646,439 (GRCm39) probably null Het
Taar5 G C 10: 23,847,120 (GRCm39) D173H possibly damaging Het
Tfrc A G 16: 32,440,101 (GRCm39) D438G probably null Het
Tinag A T 9: 76,907,131 (GRCm39) I368K probably benign Het
Tm9sf1 A G 14: 55,873,906 (GRCm39) W531R probably damaging Het
Tnc G T 4: 63,918,961 (GRCm39) P1154Q possibly damaging Het
Toporsl A G 4: 52,611,645 (GRCm39) R513G probably damaging Het
Vat1 A G 11: 101,356,956 (GRCm39) S2P probably benign Het
Vmn2r107 C G 17: 20,577,270 (GRCm39) P423A probably benign Het
Vmn2r2 T A 3: 64,024,808 (GRCm39) E591V probably damaging Het
Vmn2r62 T A 7: 42,437,281 (GRCm39) Y401F probably damaging Het
Vmn2r62 G A 7: 42,414,031 (GRCm39) T804I probably damaging Het
Vmn2r89 A T 14: 51,693,459 (GRCm39) I270F probably damaging Het
Zfp418 T C 7: 7,185,167 (GRCm39) F377L possibly damaging Het
Zkscan5 T C 5: 145,144,502 (GRCm39) S182P unknown Het
Other mutations in Rcn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00975:Rcn1 APN 2 105,225,174 (GRCm39) missense possibly damaging 0.83
IGL02347:Rcn1 APN 2 105,229,471 (GRCm39) missense probably benign 0.17
californianus UTSW 2 105,219,320 (GRCm39) critical splice donor site probably null
gymnogyps UTSW 2 105,219,518 (GRCm39) missense probably benign 0.06
P0031:Rcn1 UTSW 2 105,219,414 (GRCm39) nonsense probably null
R0107:Rcn1 UTSW 2 105,225,126 (GRCm39) missense possibly damaging 0.79
R1510:Rcn1 UTSW 2 105,219,434 (GRCm39) missense probably damaging 1.00
R1699:Rcn1 UTSW 2 105,229,350 (GRCm39) missense probably damaging 1.00
R4027:Rcn1 UTSW 2 105,229,395 (GRCm39) nonsense probably null
R4028:Rcn1 UTSW 2 105,229,395 (GRCm39) nonsense probably null
R4029:Rcn1 UTSW 2 105,229,395 (GRCm39) nonsense probably null
R4923:Rcn1 UTSW 2 105,219,518 (GRCm39) missense probably benign 0.06
R4956:Rcn1 UTSW 2 105,225,121 (GRCm39) nonsense probably null
R5079:Rcn1 UTSW 2 105,229,402 (GRCm39) missense probably damaging 0.96
R5333:Rcn1 UTSW 2 105,219,471 (GRCm39) missense probably benign 0.00
R5709:Rcn1 UTSW 2 105,225,128 (GRCm39) missense probably damaging 1.00
R6160:Rcn1 UTSW 2 105,222,362 (GRCm39) missense probably damaging 1.00
R6525:Rcn1 UTSW 2 105,219,320 (GRCm39) critical splice donor site probably null
R7111:Rcn1 UTSW 2 105,219,359 (GRCm39) missense probably damaging 1.00
R7388:Rcn1 UTSW 2 105,222,336 (GRCm39) missense probably damaging 0.98
R8515:Rcn1 UTSW 2 105,219,464 (GRCm39) missense probably null 0.97
R9765:Rcn1 UTSW 2 105,225,026 (GRCm39) missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- GAACAGTTTCCTCCCTGGTC -3'
(R):5'- GCACTAAGGTCGATTATGGGG -3'

Sequencing Primer
(F):5'- CTGGTCTTTTCGCAGTCTGTCTAG -3'
(R):5'- TGGCGTCATTTTGAATAGCAATG -3'
Posted On 2020-09-15