Incidental Mutation 'R7974:Vmn2r2'
ID 650760
Institutional Source Beutler Lab
Gene Symbol Vmn2r2
Ensembl Gene ENSMUSG00000043897
Gene Name vomeronasal 2, receptor 2
Synonyms
MMRRC Submission 046017-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.108) question?
Stock # R7974 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 64022699-64049349 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 64024808 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Valine at position 591 (E591V)
Ref Sequence ENSEMBL: ENSMUSP00000135110 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077958] [ENSMUST00000177151]
AlphaFold L7N2E9
Predicted Effect probably damaging
Transcript: ENSMUST00000077958
AA Change: E507V

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000077109
Gene: ENSMUSG00000043897
AA Change: E507V

DomainStartEndE-ValueType
Pfam:ANF_receptor 1 416 4.5e-80 PFAM
Pfam:NCD3G 458 511 8.3e-18 PFAM
Pfam:7tm_3 542 779 1.3e-75 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000177151
AA Change: E591V

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000135110
Gene: ENSMUSG00000043897
AA Change: E591V

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 83 500 1.6e-84 PFAM
Pfam:NCD3G 542 595 2.6e-17 PFAM
Pfam:7tm_3 628 862 1.9e-47 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (64/64)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 C T 19: 57,033,405 (GRCm39) probably null Het
Adamts19 A T 18: 59,144,094 (GRCm39) Q892L possibly damaging Het
Adamts9 A G 6: 92,886,668 (GRCm39) probably null Het
Aftph T C 11: 20,648,233 (GRCm39) *686W probably null Het
AI661453 T C 17: 47,777,006 (GRCm39) L244P unknown Het
Ankar C A 1: 72,738,138 (GRCm39) E15* probably null Het
Ankrd39 A G 1: 36,585,999 (GRCm39) probably benign Het
Arsi A G 18: 61,045,478 (GRCm39) D56G probably damaging Het
Blmh T C 11: 76,856,729 (GRCm39) I245T possibly damaging Het
Ccr6 T C 17: 8,475,056 (GRCm39) F87S probably damaging Het
Cdc42ep2 T C 19: 5,968,523 (GRCm39) K61E probably damaging Het
Celsr1 C T 15: 85,915,231 (GRCm39) G914D probably damaging Het
Cep126 T A 9: 8,120,764 (GRCm39) K86N probably benign Het
Cfap70 A T 14: 20,470,818 (GRCm39) F532I probably damaging Het
Cpsf3 T A 12: 21,358,006 (GRCm39) L506Q probably damaging Het
Dct A C 14: 118,277,067 (GRCm39) I273S probably damaging Het
Dsel T C 1: 111,788,229 (GRCm39) I769V probably benign Het
Dus2 G A 8: 106,762,652 (GRCm39) E138K probably benign Het
Emsy A G 7: 98,279,425 (GRCm39) S305P possibly damaging Het
Erp27 A T 6: 136,885,063 (GRCm39) V245D probably damaging Het
Fez1 C A 9: 36,755,244 (GRCm39) T81K probably damaging Het
Gli3 A C 13: 15,900,841 (GRCm39) Q1409H probably benign Het
Hdac9 T C 12: 34,353,219 (GRCm39) S664G possibly damaging Het
Hibadh A G 6: 52,534,880 (GRCm39) S167P probably benign Het
Hsdl1 A G 8: 120,293,072 (GRCm39) V121A probably benign Het
Ift70a1 T C 2: 75,810,688 (GRCm39) H465R probably damaging Het
Ighv1-18 A C 12: 114,646,669 (GRCm39) I6S possibly damaging Het
Iqcm T A 8: 76,281,520 (GRCm39) M1K probably null Het
Itch T C 2: 155,034,079 (GRCm39) F417S probably damaging Het
Itpr1 C T 6: 108,500,366 (GRCm39) T2653I possibly damaging Het
Kank1 T G 19: 25,401,584 (GRCm39) Y1064D probably damaging Het
Kmt2c T C 5: 25,505,561 (GRCm39) Q3249R probably damaging Het
Lefty1 T C 1: 180,765,385 (GRCm39) C318R probably damaging Het
Lmbr1l C T 15: 98,809,500 (GRCm39) V147I probably benign Het
Meig1 C A 2: 3,412,911 (GRCm39) E37* probably null Het
Mpp3 A G 11: 101,899,180 (GRCm39) probably null Het
Muc17 T C 5: 137,175,664 (GRCm39) N2S Het
Mup7 T C 4: 60,067,518 (GRCm39) E199G possibly damaging Het
Nol4 G C 18: 22,852,082 (GRCm39) Y275* probably null Het
Nrxn1 G A 17: 91,008,207 (GRCm39) P429S probably damaging Het
Or14j8 T C 17: 38,263,672 (GRCm39) Y81C probably damaging Het
Pfkl A T 10: 77,829,996 (GRCm39) F367L probably damaging Het
Pik3cg T C 12: 32,254,031 (GRCm39) E652G probably benign Het
Prkag3 A G 1: 74,783,980 (GRCm39) I301T probably benign Het
Rcn1 G A 2: 105,224,055 (GRCm39) P163L probably benign Het
Slc1a7 G A 4: 107,869,473 (GRCm39) V513M probably benign Het
Slc37a2 A T 9: 37,150,421 (GRCm39) probably null Het
Slc9b1 C T 3: 135,099,791 (GRCm39) T437I possibly damaging Het
Smap1 T G 1: 23,888,522 (GRCm39) T248P probably benign Het
Smpd3 A C 8: 106,982,254 (GRCm39) C617G probably benign Het
Spata20 T C 11: 94,374,966 (GRCm39) N212S possibly damaging Het
Sphkap A C 1: 83,256,683 (GRCm39) C355W probably damaging Het
Spopfm2 T C 3: 94,082,848 (GRCm39) K321R probably benign Het
Spsb1 T A 4: 149,991,566 (GRCm39) M1L probably damaging Het
Srebf2 C T 15: 82,062,966 (GRCm39) R468C probably damaging Het
Stxbp5 A C 10: 9,646,439 (GRCm39) probably null Het
Taar5 G C 10: 23,847,120 (GRCm39) D173H possibly damaging Het
Tfrc A G 16: 32,440,101 (GRCm39) D438G probably null Het
Tinag A T 9: 76,907,131 (GRCm39) I368K probably benign Het
Tm9sf1 A G 14: 55,873,906 (GRCm39) W531R probably damaging Het
Tnc G T 4: 63,918,961 (GRCm39) P1154Q possibly damaging Het
Toporsl A G 4: 52,611,645 (GRCm39) R513G probably damaging Het
Vat1 A G 11: 101,356,956 (GRCm39) S2P probably benign Het
Vmn2r107 C G 17: 20,577,270 (GRCm39) P423A probably benign Het
Vmn2r62 T A 7: 42,437,281 (GRCm39) Y401F probably damaging Het
Vmn2r62 G A 7: 42,414,031 (GRCm39) T804I probably damaging Het
Vmn2r89 A T 14: 51,693,459 (GRCm39) I270F probably damaging Het
Zfp418 T C 7: 7,185,167 (GRCm39) F377L possibly damaging Het
Zkscan5 T C 5: 145,144,502 (GRCm39) S182P unknown Het
Other mutations in Vmn2r2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00326:Vmn2r2 APN 3 64,041,319 (GRCm39) splice site probably benign
IGL00980:Vmn2r2 APN 3 64,024,601 (GRCm39) missense probably benign 0.11
IGL01389:Vmn2r2 APN 3 64,024,430 (GRCm39) missense probably damaging 0.97
IGL01804:Vmn2r2 APN 3 64,041,677 (GRCm39) missense possibly damaging 0.91
IGL02750:Vmn2r2 APN 3 64,024,823 (GRCm39) missense probably damaging 1.00
IGL02829:Vmn2r2 APN 3 64,026,172 (GRCm39) splice site probably benign
IGL03036:Vmn2r2 APN 3 64,024,321 (GRCm39) missense probably benign 0.01
IGL03174:Vmn2r2 APN 3 64,024,544 (GRCm39) nonsense probably null
PIT4151001:Vmn2r2 UTSW 3 64,024,334 (GRCm39) missense possibly damaging 0.67
R0029:Vmn2r2 UTSW 3 64,024,365 (GRCm39) missense probably benign 0.00
R0310:Vmn2r2 UTSW 3 64,042,039 (GRCm39) missense probably damaging 1.00
R0357:Vmn2r2 UTSW 3 64,041,320 (GRCm39) splice site probably null
R0637:Vmn2r2 UTSW 3 64,033,999 (GRCm39) missense probably benign 0.00
R1626:Vmn2r2 UTSW 3 64,041,921 (GRCm39) missense possibly damaging 0.61
R1662:Vmn2r2 UTSW 3 64,024,551 (GRCm39) missense probably benign 0.00
R1710:Vmn2r2 UTSW 3 64,024,820 (GRCm39) missense probably benign 0.19
R1797:Vmn2r2 UTSW 3 64,042,128 (GRCm39) missense probably benign 0.00
R1862:Vmn2r2 UTSW 3 64,041,942 (GRCm39) missense possibly damaging 0.79
R1971:Vmn2r2 UTSW 3 64,034,121 (GRCm39) missense probably damaging 1.00
R2051:Vmn2r2 UTSW 3 64,024,766 (GRCm39) missense possibly damaging 0.77
R2099:Vmn2r2 UTSW 3 64,024,474 (GRCm39) missense probably damaging 1.00
R2275:Vmn2r2 UTSW 3 64,023,930 (GRCm39) missense probably benign 0.00
R3078:Vmn2r2 UTSW 3 64,042,053 (GRCm39) missense probably benign 0.22
R3418:Vmn2r2 UTSW 3 64,024,320 (GRCm39) missense probably benign 0.00
R3419:Vmn2r2 UTSW 3 64,024,320 (GRCm39) missense probably benign 0.00
R3959:Vmn2r2 UTSW 3 64,047,947 (GRCm39) missense probably benign
R4230:Vmn2r2 UTSW 3 64,041,912 (GRCm39) missense probably benign 0.00
R4258:Vmn2r2 UTSW 3 64,042,118 (GRCm39) missense probably damaging 1.00
R4810:Vmn2r2 UTSW 3 64,044,883 (GRCm39) missense probably damaging 1.00
R4822:Vmn2r2 UTSW 3 64,041,960 (GRCm39) missense probably damaging 0.99
R4919:Vmn2r2 UTSW 3 64,024,578 (GRCm39) missense possibly damaging 0.56
R4925:Vmn2r2 UTSW 3 64,044,892 (GRCm39) start codon destroyed probably null 0.03
R4954:Vmn2r2 UTSW 3 64,047,905 (GRCm39) missense probably benign 0.00
R5071:Vmn2r2 UTSW 3 64,024,321 (GRCm39) missense probably benign 0.01
R5315:Vmn2r2 UTSW 3 64,024,377 (GRCm39) missense probably benign 0.37
R5450:Vmn2r2 UTSW 3 64,034,011 (GRCm39) missense probably benign
R5577:Vmn2r2 UTSW 3 64,024,416 (GRCm39) missense probably benign 0.00
R5595:Vmn2r2 UTSW 3 64,034,036 (GRCm39) missense possibly damaging 0.74
R5727:Vmn2r2 UTSW 3 64,024,608 (GRCm39) missense probably benign 0.41
R5810:Vmn2r2 UTSW 3 64,024,815 (GRCm39) missense probably damaging 1.00
R5919:Vmn2r2 UTSW 3 64,044,723 (GRCm39) missense probably benign 0.39
R6052:Vmn2r2 UTSW 3 64,024,782 (GRCm39) missense possibly damaging 0.56
R6084:Vmn2r2 UTSW 3 64,024,467 (GRCm39) missense probably benign 0.01
R6299:Vmn2r2 UTSW 3 64,024,074 (GRCm39) nonsense probably null
R6762:Vmn2r2 UTSW 3 64,041,870 (GRCm39) missense probably damaging 1.00
R6858:Vmn2r2 UTSW 3 64,044,915 (GRCm39) missense probably damaging 1.00
R6889:Vmn2r2 UTSW 3 64,024,688 (GRCm39) missense probably damaging 0.99
R6990:Vmn2r2 UTSW 3 64,024,608 (GRCm39) missense probably benign 0.02
R7195:Vmn2r2 UTSW 3 64,023,900 (GRCm39) missense probably benign 0.01
R7269:Vmn2r2 UTSW 3 64,033,998 (GRCm39) missense probably benign 0.32
R7699:Vmn2r2 UTSW 3 64,024,536 (GRCm39) missense possibly damaging 0.69
R7717:Vmn2r2 UTSW 3 64,042,019 (GRCm39) missense possibly damaging 0.95
R7798:Vmn2r2 UTSW 3 64,041,518 (GRCm39) missense possibly damaging 0.60
R7914:Vmn2r2 UTSW 3 64,041,526 (GRCm39) missense probably benign 0.20
R8394:Vmn2r2 UTSW 3 64,044,858 (GRCm39) missense probably damaging 1.00
R8478:Vmn2r2 UTSW 3 64,024,257 (GRCm39) missense possibly damaging 0.87
R8731:Vmn2r2 UTSW 3 64,024,404 (GRCm39) missense probably benign 0.16
R9035:Vmn2r2 UTSW 3 64,024,172 (GRCm39) missense probably damaging 1.00
R9182:Vmn2r2 UTSW 3 64,044,802 (GRCm39) missense probably damaging 1.00
R9225:Vmn2r2 UTSW 3 64,034,021 (GRCm39) missense probably benign 0.00
R9266:Vmn2r2 UTSW 3 64,024,057 (GRCm39) missense probably damaging 0.98
R9427:Vmn2r2 UTSW 3 64,041,945 (GRCm39) missense probably damaging 1.00
R9659:Vmn2r2 UTSW 3 64,041,942 (GRCm39) missense possibly damaging 0.79
R9666:Vmn2r2 UTSW 3 64,023,870 (GRCm39) missense probably benign 0.08
R9771:Vmn2r2 UTSW 3 64,042,079 (GRCm39) missense possibly damaging 0.88
R9788:Vmn2r2 UTSW 3 64,041,942 (GRCm39) missense possibly damaging 0.79
X0024:Vmn2r2 UTSW 3 64,044,707 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGGCTTTCACCAATGGAGTGTG -3'
(R):5'- AGCCCTCGATCTATTACTGCAC -3'

Sequencing Primer
(F):5'- ACCAATGGAGTGTGTCTGTGGATTAC -3'
(R):5'- GTGACAACTGGGTTCCATT -3'
Posted On 2020-09-15