Incidental Mutation 'R7974:Spopfm2'
ID 650761
Institutional Source Beutler Lab
Gene Symbol Spopfm2
Ensembl Gene ENSMUSG00000074424
Gene Name speckle-type BTB/POZ protein family member 2
Synonyms Gm10696
MMRRC Submission 046017-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.928) question?
Stock # R7974 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 94081719-94085500 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 94082848 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 321 (K321R)
Ref Sequence ENSEMBL: ENSMUSP00000124942 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000161475] [ENSMUST00000167916]
AlphaFold Q3UTC4
Predicted Effect probably benign
Transcript: ENSMUST00000161475
AA Change: K321R

PolyPhen 2 Score 0.183 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000124942
Gene: ENSMUSG00000074424
AA Change: K321R

DomainStartEndE-ValueType
MATH 24 130 4.7e-10 SMART
BTB 188 287 1.53e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167916
AA Change: K321R

PolyPhen 2 Score 0.183 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000132199
Gene: ENSMUSG00000074424
AA Change: K321R

DomainStartEndE-ValueType
MATH 24 130 4.7e-10 SMART
BTB 188 287 1.53e-25 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (64/64)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 C T 19: 57,033,405 (GRCm39) probably null Het
Adamts19 A T 18: 59,144,094 (GRCm39) Q892L possibly damaging Het
Adamts9 A G 6: 92,886,668 (GRCm39) probably null Het
Aftph T C 11: 20,648,233 (GRCm39) *686W probably null Het
AI661453 T C 17: 47,777,006 (GRCm39) L244P unknown Het
Ankar C A 1: 72,738,138 (GRCm39) E15* probably null Het
Ankrd39 A G 1: 36,585,999 (GRCm39) probably benign Het
Arsi A G 18: 61,045,478 (GRCm39) D56G probably damaging Het
Blmh T C 11: 76,856,729 (GRCm39) I245T possibly damaging Het
Ccr6 T C 17: 8,475,056 (GRCm39) F87S probably damaging Het
Cdc42ep2 T C 19: 5,968,523 (GRCm39) K61E probably damaging Het
Celsr1 C T 15: 85,915,231 (GRCm39) G914D probably damaging Het
Cep126 T A 9: 8,120,764 (GRCm39) K86N probably benign Het
Cfap70 A T 14: 20,470,818 (GRCm39) F532I probably damaging Het
Cpsf3 T A 12: 21,358,006 (GRCm39) L506Q probably damaging Het
Dct A C 14: 118,277,067 (GRCm39) I273S probably damaging Het
Dsel T C 1: 111,788,229 (GRCm39) I769V probably benign Het
Dus2 G A 8: 106,762,652 (GRCm39) E138K probably benign Het
Emsy A G 7: 98,279,425 (GRCm39) S305P possibly damaging Het
Erp27 A T 6: 136,885,063 (GRCm39) V245D probably damaging Het
Fez1 C A 9: 36,755,244 (GRCm39) T81K probably damaging Het
Gli3 A C 13: 15,900,841 (GRCm39) Q1409H probably benign Het
Hdac9 T C 12: 34,353,219 (GRCm39) S664G possibly damaging Het
Hibadh A G 6: 52,534,880 (GRCm39) S167P probably benign Het
Hsdl1 A G 8: 120,293,072 (GRCm39) V121A probably benign Het
Ift70a1 T C 2: 75,810,688 (GRCm39) H465R probably damaging Het
Ighv1-18 A C 12: 114,646,669 (GRCm39) I6S possibly damaging Het
Iqcm T A 8: 76,281,520 (GRCm39) M1K probably null Het
Itch T C 2: 155,034,079 (GRCm39) F417S probably damaging Het
Itpr1 C T 6: 108,500,366 (GRCm39) T2653I possibly damaging Het
Kank1 T G 19: 25,401,584 (GRCm39) Y1064D probably damaging Het
Kmt2c T C 5: 25,505,561 (GRCm39) Q3249R probably damaging Het
Lefty1 T C 1: 180,765,385 (GRCm39) C318R probably damaging Het
Lmbr1l C T 15: 98,809,500 (GRCm39) V147I probably benign Het
Meig1 C A 2: 3,412,911 (GRCm39) E37* probably null Het
Mpp3 A G 11: 101,899,180 (GRCm39) probably null Het
Muc17 T C 5: 137,175,664 (GRCm39) N2S Het
Mup7 T C 4: 60,067,518 (GRCm39) E199G possibly damaging Het
Nol4 G C 18: 22,852,082 (GRCm39) Y275* probably null Het
Nrxn1 G A 17: 91,008,207 (GRCm39) P429S probably damaging Het
Or14j8 T C 17: 38,263,672 (GRCm39) Y81C probably damaging Het
Pfkl A T 10: 77,829,996 (GRCm39) F367L probably damaging Het
Pik3cg T C 12: 32,254,031 (GRCm39) E652G probably benign Het
Prkag3 A G 1: 74,783,980 (GRCm39) I301T probably benign Het
Rcn1 G A 2: 105,224,055 (GRCm39) P163L probably benign Het
Slc1a7 G A 4: 107,869,473 (GRCm39) V513M probably benign Het
Slc37a2 A T 9: 37,150,421 (GRCm39) probably null Het
Slc9b1 C T 3: 135,099,791 (GRCm39) T437I possibly damaging Het
Smap1 T G 1: 23,888,522 (GRCm39) T248P probably benign Het
Smpd3 A C 8: 106,982,254 (GRCm39) C617G probably benign Het
Spata20 T C 11: 94,374,966 (GRCm39) N212S possibly damaging Het
Sphkap A C 1: 83,256,683 (GRCm39) C355W probably damaging Het
Spsb1 T A 4: 149,991,566 (GRCm39) M1L probably damaging Het
Srebf2 C T 15: 82,062,966 (GRCm39) R468C probably damaging Het
Stxbp5 A C 10: 9,646,439 (GRCm39) probably null Het
Taar5 G C 10: 23,847,120 (GRCm39) D173H possibly damaging Het
Tfrc A G 16: 32,440,101 (GRCm39) D438G probably null Het
Tinag A T 9: 76,907,131 (GRCm39) I368K probably benign Het
Tm9sf1 A G 14: 55,873,906 (GRCm39) W531R probably damaging Het
Tnc G T 4: 63,918,961 (GRCm39) P1154Q possibly damaging Het
Toporsl A G 4: 52,611,645 (GRCm39) R513G probably damaging Het
Vat1 A G 11: 101,356,956 (GRCm39) S2P probably benign Het
Vmn2r107 C G 17: 20,577,270 (GRCm39) P423A probably benign Het
Vmn2r2 T A 3: 64,024,808 (GRCm39) E591V probably damaging Het
Vmn2r62 T A 7: 42,437,281 (GRCm39) Y401F probably damaging Het
Vmn2r62 G A 7: 42,414,031 (GRCm39) T804I probably damaging Het
Vmn2r89 A T 14: 51,693,459 (GRCm39) I270F probably damaging Het
Zfp418 T C 7: 7,185,167 (GRCm39) F377L possibly damaging Het
Zkscan5 T C 5: 145,144,502 (GRCm39) S182P unknown Het
Other mutations in Spopfm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01744:Spopfm2 APN 3 94,083,544 (GRCm39) missense probably damaging 1.00
IGL02057:Spopfm2 APN 3 94,083,662 (GRCm39) missense probably damaging 1.00
R1983:Spopfm2 UTSW 3 94,083,601 (GRCm39) missense possibly damaging 0.89
R2102:Spopfm2 UTSW 3 94,082,973 (GRCm39) nonsense probably null
R2110:Spopfm2 UTSW 3 94,082,834 (GRCm39) missense probably damaging 0.99
R2172:Spopfm2 UTSW 3 94,083,605 (GRCm39) missense possibly damaging 0.68
R2358:Spopfm2 UTSW 3 94,082,855 (GRCm39) missense possibly damaging 0.61
R2358:Spopfm2 UTSW 3 94,082,854 (GRCm39) missense possibly damaging 0.81
R4534:Spopfm2 UTSW 3 94,083,757 (GRCm39) missense probably benign 0.39
R4939:Spopfm2 UTSW 3 94,083,540 (GRCm39) nonsense probably null
R4961:Spopfm2 UTSW 3 94,082,841 (GRCm39) nonsense probably null
R4993:Spopfm2 UTSW 3 94,083,623 (GRCm39) missense probably damaging 1.00
R7154:Spopfm2 UTSW 3 94,083,526 (GRCm39) missense probably benign 0.17
R7218:Spopfm2 UTSW 3 94,082,856 (GRCm39) missense possibly damaging 0.91
R7256:Spopfm2 UTSW 3 94,083,667 (GRCm39) missense probably benign 0.01
R7464:Spopfm2 UTSW 3 94,083,411 (GRCm39) missense probably benign 0.08
R7473:Spopfm2 UTSW 3 94,083,509 (GRCm39) nonsense probably null
R7596:Spopfm2 UTSW 3 94,083,737 (GRCm39) missense probably benign 0.12
R8419:Spopfm2 UTSW 3 94,082,921 (GRCm39) missense probably benign 0.06
R8497:Spopfm2 UTSW 3 94,083,119 (GRCm39) missense possibly damaging 0.93
R8519:Spopfm2 UTSW 3 94,083,497 (GRCm39) missense probably benign 0.05
R8686:Spopfm2 UTSW 3 94,083,427 (GRCm39) missense probably benign 0.01
R9223:Spopfm2 UTSW 3 94,082,950 (GRCm39) missense probably damaging 1.00
R9748:Spopfm2 UTSW 3 94,083,155 (GRCm39) missense probably damaging 0.99
Z1177:Spopfm2 UTSW 3 94,083,409 (GRCm39) missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGTACTCTAACCAGAAATCAGTGG -3'
(R):5'- CACATTCACTCCATGGCCTG -3'

Sequencing Primer
(F):5'- CAACACTGGTTATAGCTGTTGGAAG -3'
(R):5'- ACTCCATGGCCTGTGATCTG -3'
Posted On 2020-09-15