Incidental Mutation 'R7974:Slc9b1'
ID 650762
Institutional Source Beutler Lab
Gene Symbol Slc9b1
Ensembl Gene ENSMUSG00000050150
Gene Name solute carrier family 9, subfamily B (NHA1, cation proton antiporter 1), member 1
Synonyms 1700094G20Rik, 4933425K02Rik, 4933424B12Rik, Nhedc1
MMRRC Submission 046017-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.082) question?
Stock # R7974 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 135053790-135103588 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 135099791 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 437 (T437I)
Ref Sequence ENSEMBL: ENSMUSP00000077644 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078568] [ENSMUST00000161417]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000078568
AA Change: T437I

PolyPhen 2 Score 0.568 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000077644
Gene: ENSMUSG00000050150
AA Change: T437I

DomainStartEndE-ValueType
low complexity region 32 105 N/A INTRINSIC
low complexity region 123 136 N/A INTRINSIC
Pfam:Na_H_Exchanger 148 542 4.7e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161417
SMART Domains Protein: ENSMUSP00000125203
Gene: ENSMUSG00000050150

DomainStartEndE-ValueType
Pfam:Na_H_Exchanger 2 75 1.1e-7 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a sodium/hydrogen exchanger and transmembrane protein. Highly conserved orthologs of this gene have been found in other mammalian species. The expression of this gene may be limited to testis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2010]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 C T 19: 57,033,405 (GRCm39) probably null Het
Adamts19 A T 18: 59,144,094 (GRCm39) Q892L possibly damaging Het
Adamts9 A G 6: 92,886,668 (GRCm39) probably null Het
Aftph T C 11: 20,648,233 (GRCm39) *686W probably null Het
AI661453 T C 17: 47,777,006 (GRCm39) L244P unknown Het
Ankar C A 1: 72,738,138 (GRCm39) E15* probably null Het
Ankrd39 A G 1: 36,585,999 (GRCm39) probably benign Het
Arsi A G 18: 61,045,478 (GRCm39) D56G probably damaging Het
Blmh T C 11: 76,856,729 (GRCm39) I245T possibly damaging Het
Ccr6 T C 17: 8,475,056 (GRCm39) F87S probably damaging Het
Cdc42ep2 T C 19: 5,968,523 (GRCm39) K61E probably damaging Het
Celsr1 C T 15: 85,915,231 (GRCm39) G914D probably damaging Het
Cep126 T A 9: 8,120,764 (GRCm39) K86N probably benign Het
Cfap70 A T 14: 20,470,818 (GRCm39) F532I probably damaging Het
Cpsf3 T A 12: 21,358,006 (GRCm39) L506Q probably damaging Het
Dct A C 14: 118,277,067 (GRCm39) I273S probably damaging Het
Dsel T C 1: 111,788,229 (GRCm39) I769V probably benign Het
Dus2 G A 8: 106,762,652 (GRCm39) E138K probably benign Het
Emsy A G 7: 98,279,425 (GRCm39) S305P possibly damaging Het
Erp27 A T 6: 136,885,063 (GRCm39) V245D probably damaging Het
Fez1 C A 9: 36,755,244 (GRCm39) T81K probably damaging Het
Gli3 A C 13: 15,900,841 (GRCm39) Q1409H probably benign Het
Hdac9 T C 12: 34,353,219 (GRCm39) S664G possibly damaging Het
Hibadh A G 6: 52,534,880 (GRCm39) S167P probably benign Het
Hsdl1 A G 8: 120,293,072 (GRCm39) V121A probably benign Het
Ift70a1 T C 2: 75,810,688 (GRCm39) H465R probably damaging Het
Ighv1-18 A C 12: 114,646,669 (GRCm39) I6S possibly damaging Het
Iqcm T A 8: 76,281,520 (GRCm39) M1K probably null Het
Itch T C 2: 155,034,079 (GRCm39) F417S probably damaging Het
Itpr1 C T 6: 108,500,366 (GRCm39) T2653I possibly damaging Het
Kank1 T G 19: 25,401,584 (GRCm39) Y1064D probably damaging Het
Kmt2c T C 5: 25,505,561 (GRCm39) Q3249R probably damaging Het
Lefty1 T C 1: 180,765,385 (GRCm39) C318R probably damaging Het
Lmbr1l C T 15: 98,809,500 (GRCm39) V147I probably benign Het
Meig1 C A 2: 3,412,911 (GRCm39) E37* probably null Het
Mpp3 A G 11: 101,899,180 (GRCm39) probably null Het
Muc17 T C 5: 137,175,664 (GRCm39) N2S Het
Mup7 T C 4: 60,067,518 (GRCm39) E199G possibly damaging Het
Nol4 G C 18: 22,852,082 (GRCm39) Y275* probably null Het
Nrxn1 G A 17: 91,008,207 (GRCm39) P429S probably damaging Het
Or14j8 T C 17: 38,263,672 (GRCm39) Y81C probably damaging Het
Pfkl A T 10: 77,829,996 (GRCm39) F367L probably damaging Het
Pik3cg T C 12: 32,254,031 (GRCm39) E652G probably benign Het
Prkag3 A G 1: 74,783,980 (GRCm39) I301T probably benign Het
Rcn1 G A 2: 105,224,055 (GRCm39) P163L probably benign Het
Slc1a7 G A 4: 107,869,473 (GRCm39) V513M probably benign Het
Slc37a2 A T 9: 37,150,421 (GRCm39) probably null Het
Smap1 T G 1: 23,888,522 (GRCm39) T248P probably benign Het
Smpd3 A C 8: 106,982,254 (GRCm39) C617G probably benign Het
Spata20 T C 11: 94,374,966 (GRCm39) N212S possibly damaging Het
Sphkap A C 1: 83,256,683 (GRCm39) C355W probably damaging Het
Spopfm2 T C 3: 94,082,848 (GRCm39) K321R probably benign Het
Spsb1 T A 4: 149,991,566 (GRCm39) M1L probably damaging Het
Srebf2 C T 15: 82,062,966 (GRCm39) R468C probably damaging Het
Stxbp5 A C 10: 9,646,439 (GRCm39) probably null Het
Taar5 G C 10: 23,847,120 (GRCm39) D173H possibly damaging Het
Tfrc A G 16: 32,440,101 (GRCm39) D438G probably null Het
Tinag A T 9: 76,907,131 (GRCm39) I368K probably benign Het
Tm9sf1 A G 14: 55,873,906 (GRCm39) W531R probably damaging Het
Tnc G T 4: 63,918,961 (GRCm39) P1154Q possibly damaging Het
Toporsl A G 4: 52,611,645 (GRCm39) R513G probably damaging Het
Vat1 A G 11: 101,356,956 (GRCm39) S2P probably benign Het
Vmn2r107 C G 17: 20,577,270 (GRCm39) P423A probably benign Het
Vmn2r2 T A 3: 64,024,808 (GRCm39) E591V probably damaging Het
Vmn2r62 T A 7: 42,437,281 (GRCm39) Y401F probably damaging Het
Vmn2r62 G A 7: 42,414,031 (GRCm39) T804I probably damaging Het
Vmn2r89 A T 14: 51,693,459 (GRCm39) I270F probably damaging Het
Zfp418 T C 7: 7,185,167 (GRCm39) F377L possibly damaging Het
Zkscan5 T C 5: 145,144,502 (GRCm39) S182P unknown Het
Other mutations in Slc9b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01979:Slc9b1 APN 3 135,077,743 (GRCm39) splice site probably null
IGL02793:Slc9b1 APN 3 135,080,167 (GRCm39) unclassified probably benign
IGL02875:Slc9b1 APN 3 135,080,167 (GRCm39) unclassified probably benign
IGL02977:Slc9b1 APN 3 135,103,484 (GRCm39) missense probably damaging 1.00
IGL02990:Slc9b1 APN 3 135,100,744 (GRCm39) splice site probably null
IGL03112:Slc9b1 APN 3 135,103,433 (GRCm39) missense probably damaging 1.00
IGL03277:Slc9b1 APN 3 135,096,269 (GRCm39) missense possibly damaging 0.46
IGL03409:Slc9b1 APN 3 135,100,670 (GRCm39) missense probably damaging 0.99
R0190:Slc9b1 UTSW 3 135,063,434 (GRCm39) missense unknown
R0329:Slc9b1 UTSW 3 135,078,996 (GRCm39) nonsense probably null
R0591:Slc9b1 UTSW 3 135,088,593 (GRCm39) missense possibly damaging 0.88
R0592:Slc9b1 UTSW 3 135,099,835 (GRCm39) splice site probably benign
R0602:Slc9b1 UTSW 3 135,103,516 (GRCm39) missense probably benign 0.00
R0893:Slc9b1 UTSW 3 135,100,651 (GRCm39) missense probably benign 0.15
R1250:Slc9b1 UTSW 3 135,054,531 (GRCm39) start codon destroyed probably null
R1619:Slc9b1 UTSW 3 135,060,765 (GRCm39) splice site probably null
R1840:Slc9b1 UTSW 3 135,063,229 (GRCm39) missense unknown
R3157:Slc9b1 UTSW 3 135,077,606 (GRCm39) missense probably damaging 1.00
R3159:Slc9b1 UTSW 3 135,077,606 (GRCm39) missense probably damaging 1.00
R4565:Slc9b1 UTSW 3 135,088,478 (GRCm39) missense probably damaging 1.00
R5138:Slc9b1 UTSW 3 135,063,534 (GRCm39) intron probably benign
R5154:Slc9b1 UTSW 3 135,078,940 (GRCm39) missense probably damaging 1.00
R5429:Slc9b1 UTSW 3 135,079,024 (GRCm39) critical splice donor site probably null
R5677:Slc9b1 UTSW 3 135,063,320 (GRCm39) missense unknown
R5903:Slc9b1 UTSW 3 135,098,655 (GRCm39) intron probably benign
R5933:Slc9b1 UTSW 3 135,099,756 (GRCm39) missense probably benign 0.30
R6593:Slc9b1 UTSW 3 135,063,219 (GRCm39) start codon destroyed probably null
R6667:Slc9b1 UTSW 3 135,077,726 (GRCm39) missense probably damaging 0.99
R6788:Slc9b1 UTSW 3 135,063,518 (GRCm39) splice site probably null
R8210:Slc9b1 UTSW 3 135,097,948 (GRCm39) missense probably damaging 1.00
R8276:Slc9b1 UTSW 3 135,077,658 (GRCm39) missense possibly damaging 0.63
R8988:Slc9b1 UTSW 3 135,078,900 (GRCm39) missense possibly damaging 0.69
R9102:Slc9b1 UTSW 3 135,100,725 (GRCm39) missense probably damaging 1.00
R9266:Slc9b1 UTSW 3 135,054,468 (GRCm39) intron probably benign
RF006:Slc9b1 UTSW 3 135,063,303 (GRCm39) small deletion probably benign
Predicted Primers PCR Primer
(F):5'- TGGCTTTAAGTTTCTGAAATGCAGC -3'
(R):5'- GAGACAGGGTTGCCTTTGAC -3'

Sequencing Primer
(F):5'- GAAATGCAGCTAAATTTATACCCAC -3'
(R):5'- ACAGGGTTGCCTTTGACTGAAAC -3'
Posted On 2020-09-15