Incidental Mutation 'R7974:Tnc'
ID650765
Institutional Source Beutler Lab
Gene Symbol Tnc
Ensembl Gene ENSMUSG00000028364
Gene Nametenascin C
SynonymsTN, TN-C, hexabrachion, tenascin-C, C130033P17Rik, cytotactin, Hxb
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7974 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location63959785-64047015 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 64000724 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 1154 (P1154Q)
Ref Sequence ENSEMBL: ENSMUSP00000030056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030056] [ENSMUST00000107372] [ENSMUST00000107377]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030056
AA Change: P1154Q

PolyPhen 2 Score 0.841 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000030056
Gene: ENSMUSG00000028364
AA Change: P1154Q

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 121 138 N/A INTRINSIC
EGF 189 217 1.87e1 SMART
EGF_like 220 248 3.5e1 SMART
EGF 251 280 4.89e0 SMART
EGF 283 311 3.23e0 SMART
EGF_like 314 342 2.98e1 SMART
EGF 345 373 1.87e1 SMART
EGF 376 404 3.97e0 SMART
EGF 407 435 8.52e0 SMART
EGF 438 466 3.01e0 SMART
EGF 469 497 3.46e0 SMART
EGF 500 528 3.71e0 SMART
EGF 531 559 4.32e-1 SMART
EGF 562 590 1.84e1 SMART
EGF 593 621 3.82e-2 SMART
FN3 623 701 8.9e-8 SMART
FN3 712 794 1.53e-6 SMART
FN3 803 884 7.23e-8 SMART
FN3 893 974 1.71e-9 SMART
FN3 985 1062 2.56e-8 SMART
FN3 1074 1152 8.58e-1 SMART
FN3 1165 1245 2.72e-3 SMART
FN3 1256 1334 5.36e-2 SMART
FN3 1347 1427 4.93e0 SMART
FN3 1438 1517 3.4e-4 SMART
FN3 1528 1606 1.55e-7 SMART
FN3 1617 1694 1.53e-6 SMART
FN3 1705 1782 7.75e-8 SMART
FBG 1797 2007 4.08e-124 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107372
AA Change: P1154Q

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000102995
Gene: ENSMUSG00000028364
AA Change: P1154Q

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 121 138 N/A INTRINSIC
EGF 189 217 1.87e1 SMART
EGF_like 220 248 3.5e1 SMART
EGF 251 280 4.89e0 SMART
EGF 283 311 3.23e0 SMART
EGF_like 314 342 2.98e1 SMART
EGF 345 373 1.87e1 SMART
EGF 376 404 3.97e0 SMART
EGF 407 435 8.52e0 SMART
EGF 438 466 3.01e0 SMART
EGF 469 497 3.46e0 SMART
EGF 500 528 3.71e0 SMART
EGF 531 559 4.32e-1 SMART
EGF 562 590 1.84e1 SMART
EGF 593 621 3.82e-2 SMART
FN3 623 701 8.9e-8 SMART
FN3 712 794 1.53e-6 SMART
FN3 803 884 7.23e-8 SMART
FN3 893 974 1.71e-9 SMART
FN3 985 1062 2.56e-8 SMART
FN3 1074 1152 8.58e-1 SMART
FN3 1165 1245 2.72e-3 SMART
FN3 1256 1334 5.36e-2 SMART
FN3 1347 1427 4.93e0 SMART
FN3 1438 1517 2.75e0 SMART
FN3 1529 1608 3.4e-4 SMART
FN3 1619 1697 1.55e-7 SMART
FN3 1708 1785 1.53e-6 SMART
FN3 1796 1873 7.75e-8 SMART
FBG 1888 2098 4.08e-124 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000107377
AA Change: P1154Q

PolyPhen 2 Score 0.841 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000103000
Gene: ENSMUSG00000028364
AA Change: P1154Q

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 121 138 N/A INTRINSIC
EGF 189 217 1.87e1 SMART
EGF_like 220 248 3.5e1 SMART
EGF 251 280 4.89e0 SMART
EGF 283 311 3.23e0 SMART
EGF_like 314 342 2.98e1 SMART
EGF 345 373 1.87e1 SMART
EGF 376 404 3.97e0 SMART
EGF 407 435 8.52e0 SMART
EGF 438 466 3.01e0 SMART
EGF 469 497 3.46e0 SMART
EGF 500 528 3.71e0 SMART
EGF 531 559 4.32e-1 SMART
EGF 562 590 1.84e1 SMART
EGF 593 621 3.82e-2 SMART
FN3 623 701 8.9e-8 SMART
FN3 712 794 1.53e-6 SMART
FN3 803 884 7.23e-8 SMART
FN3 893 974 1.71e-9 SMART
FN3 985 1062 2.56e-8 SMART
FN3 1074 1152 8.58e-1 SMART
FN3 1165 1245 2.72e-3 SMART
FN3 1256 1334 5.36e-2 SMART
FN3 1347 1427 4.93e0 SMART
FN3 1438 1517 3.4e-4 SMART
FN3 1528 1606 1.55e-7 SMART
FN3 1617 1694 1.53e-6 SMART
FN3 1705 1782 7.75e-8 SMART
FBG 1797 2007 4.08e-124 SMART
Meta Mutation Damage Score 0.1617 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an extracellular matrix protein with a spatially and temporally restricted tissue distribution. This protein is homohexameric with disulfide-linked subunits, and contains multiple EGF-like and fibronectin type-III domains. It is implicated in guidance of migrating neurons as well as axons during development, synaptic plasticity, and neuronal regeneration. [provided by RefSeq, Jul 2011]
PHENOTYPE: Mice homozygous for several different targeted mutations show variable behavioral and nervous system phenotypes such as abnormal circadian rhythm, anxiety behavior, novelty-induced activity, swimming, impaired synaptic plasticity, long term potentiation and serotonin and dopamine neurotransmission. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 C T 19: 57,044,973 probably null Het
Adamts19 A T 18: 59,011,022 Q892L possibly damaging Het
Adamts9 A G 6: 92,909,687 probably null Het
Aftph T C 11: 20,698,233 *686W probably null Het
AI661453 T C 17: 47,466,081 L244P unknown Het
Ankar C A 1: 72,698,979 E15* probably null Het
Ankrd39 A G 1: 36,546,918 probably benign Het
Arsi A G 18: 60,912,406 D56G probably damaging Het
Blmh T C 11: 76,965,903 I245T possibly damaging Het
Ccr6 T C 17: 8,256,224 F87S probably damaging Het
Cdc42ep2 T C 19: 5,918,495 K61E probably damaging Het
Celsr1 C T 15: 86,031,030 G914D probably damaging Het
Cep126 T A 9: 8,120,763 K86N probably benign Het
Cfap70 A T 14: 20,420,750 F532I probably damaging Het
Cpsf3 T A 12: 21,308,005 L506Q probably damaging Het
Dct A C 14: 118,039,655 I273S probably damaging Het
Dsel T C 1: 111,860,499 I769V probably benign Het
Dus2 G A 8: 106,036,020 E138K probably benign Het
Emsy A G 7: 98,630,218 S305P possibly damaging Het
Erp27 A T 6: 136,908,065 V245D probably damaging Het
Fez1 C A 9: 36,843,948 T81K probably damaging Het
Gli3 A C 13: 15,726,256 Q1409H probably benign Het
Gm10696 T C 3: 94,175,541 K321R probably benign Het
Hdac9 T C 12: 34,303,220 S664G possibly damaging Het
Hibadh A G 6: 52,557,895 S167P probably benign Het
Hsdl1 A G 8: 119,566,333 V121A probably benign Het
Ighv1-18 A C 12: 114,683,049 I6S possibly damaging Het
Iqcm T A 8: 75,554,892 M1K probably null Het
Itch T C 2: 155,192,159 F417S probably damaging Het
Itpr1 C T 6: 108,523,405 T2653I possibly damaging Het
Kank1 T G 19: 25,424,220 Y1064D probably damaging Het
Kmt2c T C 5: 25,300,563 Q3249R probably damaging Het
Lefty1 T C 1: 180,937,820 C318R probably damaging Het
Lmbr1l C T 15: 98,911,619 V147I probably benign Het
Meig1 C A 2: 3,411,874 E37* probably null Het
Mpp3 A G 11: 102,008,354 probably null Het
Muc3 T C 5: 137,146,816 N2S Het
Mup7 T C 4: 60,067,518 E199G possibly damaging Het
Nol4 G C 18: 22,719,025 Y275* probably null Het
Nrxn1 G A 17: 90,700,779 P429S probably damaging Het
Olfr761 T C 17: 37,952,781 Y81C probably damaging Het
Pfkl A T 10: 77,994,162 F367L probably damaging Het
Pik3cg T C 12: 32,204,032 E652G probably benign Het
Prkag3 A G 1: 74,744,821 I301T probably benign Het
Rcn1 G A 2: 105,393,710 P163L probably benign Het
Slc1a7 G A 4: 108,012,276 V513M probably benign Het
Slc37a2 A T 9: 37,239,125 probably null Het
Slc9b1 C T 3: 135,394,030 T437I possibly damaging Het
Smap1 T G 1: 23,849,441 T248P probably benign Het
Smpd3 A C 8: 106,255,622 C617G probably benign Het
Spata20 T C 11: 94,484,140 N212S possibly damaging Het
Sphkap A C 1: 83,278,962 C355W probably damaging Het
Spsb1 T A 4: 149,907,109 M1L probably damaging Het
Srebf2 C T 15: 82,178,765 R468C probably damaging Het
Stxbp5 A C 10: 9,770,695 probably null Het
Taar5 G C 10: 23,971,222 D173H possibly damaging Het
Tfrc A G 16: 32,621,283 D438G probably null Het
Tinag A T 9: 76,999,849 I368K probably benign Het
Tm9sf1 A G 14: 55,636,449 W531R probably damaging Het
Toporsl A G 4: 52,611,645 R513G probably damaging Het
Ttc30a1 T C 2: 75,980,344 H465R probably damaging Het
Vat1 A G 11: 101,466,130 S2P probably benign Het
Vmn2r107 C G 17: 20,357,008 P423A probably benign Het
Vmn2r2 T A 3: 64,117,387 E591V probably damaging Het
Vmn2r62 G A 7: 42,764,607 T804I probably damaging Het
Vmn2r62 T A 7: 42,787,857 Y401F probably damaging Het
Vmn2r89 A T 14: 51,456,002 I270F probably damaging Het
Zfp418 T C 7: 7,182,168 F377L possibly damaging Het
Zkscan5 T C 5: 145,207,692 S182P unknown Het
Other mutations in Tnc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Tnc APN 4 64016824 splice site probably benign
IGL00531:Tnc APN 4 63971153 splice site probably benign
IGL00674:Tnc APN 4 63965607 missense probably damaging 1.00
IGL01015:Tnc APN 4 64017334 missense probably benign 0.19
IGL01090:Tnc APN 4 64000080 missense probably damaging 1.00
IGL01310:Tnc APN 4 64013077 missense probably benign 0.03
IGL01331:Tnc APN 4 63982875 missense probably damaging 0.99
IGL01393:Tnc APN 4 64014054 splice site probably benign
IGL01411:Tnc APN 4 64000722 missense probably damaging 0.96
IGL01472:Tnc APN 4 64006419 missense probably benign 0.00
IGL01552:Tnc APN 4 63970408 missense probably damaging 1.00
IGL01661:Tnc APN 4 63970307 splice site probably benign
IGL01669:Tnc APN 4 64000701 missense probably damaging 1.00
IGL01912:Tnc APN 4 64008740 missense probably damaging 1.00
IGL02028:Tnc APN 4 63966672 splice site probably benign
IGL02100:Tnc APN 4 64000161 missense possibly damaging 0.84
IGL02549:Tnc APN 4 64015072 missense probably damaging 1.00
IGL02642:Tnc APN 4 63965579 splice site probably benign
IGL02712:Tnc APN 4 63975256 missense probably damaging 1.00
IGL02876:Tnc APN 4 64015101 missense possibly damaging 0.56
IGL02886:Tnc APN 4 64000107 missense probably damaging 0.96
IGL02972:Tnc APN 4 63976478 missense probably benign 0.11
IGL03073:Tnc APN 4 63971224 missense possibly damaging 0.58
IGL03116:Tnc APN 4 64014033 missense probably damaging 1.00
IGL03181:Tnc APN 4 63967306 missense possibly damaging 0.95
IGL03358:Tnc APN 4 64017615 nonsense probably null
tancredo UTSW 4 63993297 nonsense probably null
BB009:Tnc UTSW 4 64008620 missense probably benign
BB019:Tnc UTSW 4 64008620 missense probably benign
P0020:Tnc UTSW 4 64008857 missense possibly damaging 0.63
PIT4377001:Tnc UTSW 4 64017736 missense probably damaging 1.00
PIT4403001:Tnc UTSW 4 63964667 missense probably damaging 1.00
PIT4468001:Tnc UTSW 4 63964667 missense probably damaging 1.00
R0243:Tnc UTSW 4 63970420 missense probably damaging 0.98
R0362:Tnc UTSW 4 64017442 missense probably damaging 1.00
R0410:Tnc UTSW 4 64007694 missense probably benign 0.00
R0420:Tnc UTSW 4 64000159 missense probably benign 0.00
R0540:Tnc UTSW 4 64020455 missense probably damaging 1.00
R0650:Tnc UTSW 4 64008734 missense probably benign 0.00
R1019:Tnc UTSW 4 63962082 missense probably damaging 1.00
R1102:Tnc UTSW 4 64020468 missense probably benign 0.05
R1126:Tnc UTSW 4 64018120 missense probably damaging 0.99
R1141:Tnc UTSW 4 64013994 missense probably damaging 1.00
R1142:Tnc UTSW 4 64013994 missense probably damaging 1.00
R1307:Tnc UTSW 4 64008859 missense probably damaging 0.98
R1322:Tnc UTSW 4 64013994 missense probably damaging 1.00
R1414:Tnc UTSW 4 63965695 splice site probably benign
R1470:Tnc UTSW 4 63966574 missense probably damaging 1.00
R1470:Tnc UTSW 4 63966574 missense probably damaging 1.00
R1499:Tnc UTSW 4 63964754 missense probably benign 0.15
R1506:Tnc UTSW 4 64007684 missense possibly damaging 0.90
R1597:Tnc UTSW 4 64006384 missense probably benign
R1750:Tnc UTSW 4 63972735 missense probably damaging 1.00
R1765:Tnc UTSW 4 64013994 missense probably damaging 1.00
R1783:Tnc UTSW 4 64018096 missense probably damaging 0.98
R1808:Tnc UTSW 4 63999931 missense probably damaging 1.00
R1903:Tnc UTSW 4 64000062 missense probably benign 0.00
R1932:Tnc UTSW 4 63993025 critical splice donor site probably null
R1941:Tnc UTSW 4 64014964 missense probably damaging 1.00
R1983:Tnc UTSW 4 63984630 missense possibly damaging 0.95
R2024:Tnc UTSW 4 63964621 missense probably damaging 1.00
R2075:Tnc UTSW 4 63995666 missense possibly damaging 0.94
R2327:Tnc UTSW 4 63975238 missense possibly damaging 0.78
R2444:Tnc UTSW 4 64014963 missense probably damaging 1.00
R2982:Tnc UTSW 4 64020519 missense possibly damaging 0.81
R3874:Tnc UTSW 4 64008710 missense probably damaging 1.00
R4110:Tnc UTSW 4 64014951 missense probably damaging 1.00
R4360:Tnc UTSW 4 64016924 missense probably benign 0.35
R4371:Tnc UTSW 4 63970351 missense probably damaging 1.00
R4434:Tnc UTSW 4 64007829 missense possibly damaging 0.91
R4438:Tnc UTSW 4 64007829 missense possibly damaging 0.91
R4570:Tnc UTSW 4 63995672 missense probably damaging 0.99
R4595:Tnc UTSW 4 63995745 missense probably damaging 1.00
R4749:Tnc UTSW 4 63995639 missense possibly damaging 0.56
R4756:Tnc UTSW 4 63967343 missense probably damaging 0.99
R4824:Tnc UTSW 4 64017620 nonsense probably null
R4957:Tnc UTSW 4 63976556 missense probably damaging 1.00
R4977:Tnc UTSW 4 64006248 missense possibly damaging 0.82
R5001:Tnc UTSW 4 63984489 missense probably damaging 1.00
R5001:Tnc UTSW 4 64000062 missense probably benign 0.16
R5015:Tnc UTSW 4 64006502 missense probably damaging 1.00
R5049:Tnc UTSW 4 64017986 missense probably damaging 1.00
R5066:Tnc UTSW 4 63975229 missense probably damaging 0.96
R5073:Tnc UTSW 4 64020411 missense probably damaging 1.00
R5116:Tnc UTSW 4 63967215 critical splice donor site probably null
R5195:Tnc UTSW 4 63967252 missense probably damaging 1.00
R5200:Tnc UTSW 4 63971278 missense probably damaging 1.00
R5221:Tnc UTSW 4 63993297 nonsense probably null
R5237:Tnc UTSW 4 63962096 missense probably damaging 1.00
R5265:Tnc UTSW 4 63993206 missense probably benign 0.00
R5275:Tnc UTSW 4 63964730 nonsense probably null
R5346:Tnc UTSW 4 64008655 missense probably benign
R5409:Tnc UTSW 4 63966536 missense probably damaging 1.00
R5409:Tnc UTSW 4 64007417 missense probably damaging 1.00
R5469:Tnc UTSW 4 64013925 splice site probably null
R5518:Tnc UTSW 4 64017679 missense probably damaging 1.00
R5560:Tnc UTSW 4 64008709 missense probably damaging 1.00
R5588:Tnc UTSW 4 64006422 missense possibly damaging 0.57
R5686:Tnc UTSW 4 64007730 splice site probably null
R5686:Tnc UTSW 4 64008795 missense possibly damaging 0.78
R5837:Tnc UTSW 4 64013214 missense probably damaging 1.00
R5976:Tnc UTSW 4 64018166 missense probably benign 0.17
R6156:Tnc UTSW 4 63970352 missense probably damaging 1.00
R6182:Tnc UTSW 4 64008796 missense probably damaging 0.99
R6360:Tnc UTSW 4 64000733 missense probably damaging 1.00
R6416:Tnc UTSW 4 64007816 missense probably benign 0.05
R6778:Tnc UTSW 4 63995598 missense probably benign 0.12
R6798:Tnc UTSW 4 63965604 missense probably benign 0.02
R6799:Tnc UTSW 4 63965604 missense probably benign 0.02
R6943:Tnc UTSW 4 63982745 missense probably damaging 0.97
R7027:Tnc UTSW 4 63984589 missense probably benign 0.02
R7183:Tnc UTSW 4 64013128 missense probably damaging 1.00
R7204:Tnc UTSW 4 63971155 splice site probably null
R7317:Tnc UTSW 4 63972722 missense probably damaging 0.99
R7323:Tnc UTSW 4 63971232 missense probably damaging 0.96
R7327:Tnc UTSW 4 63964762 splice site probably null
R7382:Tnc UTSW 4 64014043 nonsense probably null
R7399:Tnc UTSW 4 64020657 start gained probably benign
R7479:Tnc UTSW 4 64017628 missense possibly damaging 0.95
R7585:Tnc UTSW 4 64020411 missense probably damaging 1.00
R7932:Tnc UTSW 4 64008620 missense probably benign
R7947:Tnc UTSW 4 64017343 missense probably damaging 1.00
R7991:Tnc UTSW 4 64008746 missense probably benign 0.42
R8004:Tnc UTSW 4 63984657 missense probably benign 0.04
R8080:Tnc UTSW 4 63976469 missense possibly damaging 0.52
R8109:Tnc UTSW 4 64008763 missense probably benign 0.11
R8145:Tnc UTSW 4 64017479 missense probably benign
R8340:Tnc UTSW 4 64007799 missense probably damaging 1.00
R8360:Tnc UTSW 4 63967274 missense probably benign 0.00
R8671:Tnc UTSW 4 64017446 missense probably damaging 1.00
R8691:Tnc UTSW 4 63962076 missense probably damaging 1.00
R8759:Tnc UTSW 4 64006264 missense possibly damaging 0.86
R8864:Tnc UTSW 4 63993059 missense probably damaging 0.98
R8928:Tnc UTSW 4 64007358 missense probably damaging 1.00
R8949:Tnc UTSW 4 64008850 missense probably damaging 1.00
R8956:Tnc UTSW 4 64000733 missense probably damaging 1.00
S24628:Tnc UTSW 4 64018012 missense probably damaging 1.00
Z1177:Tnc UTSW 4 63960544 critical splice acceptor site probably null
Z1177:Tnc UTSW 4 64007426 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCCATACAGCAGCAATGTGTTG -3'
(R):5'- AGATGACCTGGCCTATGAGTAC -3'

Sequencing Primer
(F):5'- CCTTAGAACTATGTCACGCGATGG -3'
(R):5'- CTTTGTCATTCAGGTACAGGAAGCC -3'
Posted On2020-09-15