Mutagenetix > Incidental Mutation

Incidental Mutation 'R7974:Tnc'

650765

Institutional Source

Beutler Lab

Gene Symbol

Tnc

Ensembl Gene

ENSMUSG00000028364

Gene Name

tenascin C

Synonyms

TN, TN-C, hexabrachion, tenascin-C, C130033P17Rik, cytotactin, Hxb

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7974 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

63959785-64047015 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 64000724 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Glutamine at position 1154 (P1154Q)

Ref Sequence

ENSEMBL: ENSMUSP00000030056 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030056] [ENSMUST00000107372] [ENSMUST00000107377]

AlphaFold

Q80YX1

Predicted Effect

possibly damaging
Transcript: ENSMUST00000030056
AA Change: P1154Q

PolyPhen 2 Score 0.841 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000030056
Gene: ENSMUSG00000028364
AA Change: P1154Q

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
low complexity region	121	138	N/A	INTRINSIC
EGF	189	217	1.87e1	SMART
EGF_like	220	248	3.5e1	SMART
EGF	251	280	4.89e0	SMART
EGF	283	311	3.23e0	SMART
EGF_like	314	342	2.98e1	SMART
EGF	345	373	1.87e1	SMART
EGF	376	404	3.97e0	SMART
EGF	407	435	8.52e0	SMART
EGF	438	466	3.01e0	SMART
EGF	469	497	3.46e0	SMART
EGF	500	528	3.71e0	SMART
EGF	531	559	4.32e-1	SMART
EGF	562	590	1.84e1	SMART
EGF	593	621	3.82e-2	SMART
FN3	623	701	8.9e-8	SMART
FN3	712	794	1.53e-6	SMART
FN3	803	884	7.23e-8	SMART
FN3	893	974	1.71e-9	SMART
FN3	985	1062	2.56e-8	SMART
FN3	1074	1152	8.58e-1	SMART
FN3	1165	1245	2.72e-3	SMART
FN3	1256	1334	5.36e-2	SMART
FN3	1347	1427	4.93e0	SMART
FN3	1438	1517	3.4e-4	SMART
FN3	1528	1606	1.55e-7	SMART
FN3	1617	1694	1.53e-6	SMART
FN3	1705	1782	7.75e-8	SMART
FBG	1797	2007	4.08e-124	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000107372
AA Change: P1154Q

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000102995
Gene: ENSMUSG00000028364
AA Change: P1154Q

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
low complexity region	121	138	N/A	INTRINSIC
EGF	189	217	1.87e1	SMART
EGF_like	220	248	3.5e1	SMART
EGF	251	280	4.89e0	SMART
EGF	283	311	3.23e0	SMART
EGF_like	314	342	2.98e1	SMART
EGF	345	373	1.87e1	SMART
EGF	376	404	3.97e0	SMART
EGF	407	435	8.52e0	SMART
EGF	438	466	3.01e0	SMART
EGF	469	497	3.46e0	SMART
EGF	500	528	3.71e0	SMART
EGF	531	559	4.32e-1	SMART
EGF	562	590	1.84e1	SMART
EGF	593	621	3.82e-2	SMART
FN3	623	701	8.9e-8	SMART
FN3	712	794	1.53e-6	SMART
FN3	803	884	7.23e-8	SMART
FN3	893	974	1.71e-9	SMART
FN3	985	1062	2.56e-8	SMART
FN3	1074	1152	8.58e-1	SMART
FN3	1165	1245	2.72e-3	SMART
FN3	1256	1334	5.36e-2	SMART
FN3	1347	1427	4.93e0	SMART
FN3	1438	1517	2.75e0	SMART
FN3	1529	1608	3.4e-4	SMART
FN3	1619	1697	1.55e-7	SMART
FN3	1708	1785	1.53e-6	SMART
FN3	1796	1873	7.75e-8	SMART
FBG	1888	2098	4.08e-124	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000107377
AA Change: P1154Q

PolyPhen 2 Score 0.841 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000103000
Gene: ENSMUSG00000028364
AA Change: P1154Q

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
low complexity region	121	138	N/A	INTRINSIC
EGF	189	217	1.87e1	SMART
EGF_like	220	248	3.5e1	SMART
EGF	251	280	4.89e0	SMART
EGF	283	311	3.23e0	SMART
EGF_like	314	342	2.98e1	SMART
EGF	345	373	1.87e1	SMART
EGF	376	404	3.97e0	SMART
EGF	407	435	8.52e0	SMART
EGF	438	466	3.01e0	SMART
EGF	469	497	3.46e0	SMART
EGF	500	528	3.71e0	SMART
EGF	531	559	4.32e-1	SMART
EGF	562	590	1.84e1	SMART
EGF	593	621	3.82e-2	SMART
FN3	623	701	8.9e-8	SMART
FN3	712	794	1.53e-6	SMART
FN3	803	884	7.23e-8	SMART
FN3	893	974	1.71e-9	SMART
FN3	985	1062	2.56e-8	SMART
FN3	1074	1152	8.58e-1	SMART
FN3	1165	1245	2.72e-3	SMART
FN3	1256	1334	5.36e-2	SMART
FN3	1347	1427	4.93e0	SMART
FN3	1438	1517	3.4e-4	SMART
FN3	1528	1606	1.55e-7	SMART
FN3	1617	1694	1.53e-6	SMART
FN3	1705	1782	7.75e-8	SMART
FBG	1797	2007	4.08e-124	SMART

Meta Mutation Damage Score

0.1617

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (64/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an extracellular matrix protein with a spatially and temporally restricted tissue distribution. This protein is homohexameric with disulfide-linked subunits, and contains multiple EGF-like and fibronectin type-III domains. It is implicated in guidance of migrating neurons as well as axons during development, synaptic plasticity, and neuronal regeneration. [provided by RefSeq, Jul 2011]
PHENOTYPE: Mice homozygous for several different targeted mutations show variable behavioral and nervous system phenotypes such as abnormal circadian rhythm, anxiety behavior, novelty-induced activity, swimming, impaired synaptic plasticity, long term potentiation and serotonin and dopamine neurotransmission. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ablim1	C	T	19: 57,044,973		probably null	Het
Adamts19	A	T	18: 59,011,022	Q892L	possibly damaging	Het
Adamts9	A	G	6: 92,909,687		probably null	Het
Aftph	T	C	11: 20,698,233	*686W	probably null	Het
AI661453	T	C	17: 47,466,081	L244P	unknown	Het
Ankar	C	A	1: 72,698,979	E15*	probably null	Het
Ankrd39	A	G	1: 36,546,918		probably benign	Het
Arsi	A	G	18: 60,912,406	D56G	probably damaging	Het
Blmh	T	C	11: 76,965,903	I245T	possibly damaging	Het
Ccr6	T	C	17: 8,256,224	F87S	probably damaging	Het
Cdc42ep2	T	C	19: 5,918,495	K61E	probably damaging	Het
Celsr1	C	T	15: 86,031,030	G914D	probably damaging	Het
Cep126	T	A	9: 8,120,763	K86N	probably benign	Het
Cfap70	A	T	14: 20,420,750	F532I	probably damaging	Het
Cpsf3	T	A	12: 21,308,005	L506Q	probably damaging	Het
Dct	A	C	14: 118,039,655	I273S	probably damaging	Het
Dsel	T	C	1: 111,860,499	I769V	probably benign	Het
Dus2	G	A	8: 106,036,020	E138K	probably benign	Het
Emsy	A	G	7: 98,630,218	S305P	possibly damaging	Het
Erp27	A	T	6: 136,908,065	V245D	probably damaging	Het
Fez1	C	A	9: 36,843,948	T81K	probably damaging	Het
Gli3	A	C	13: 15,726,256	Q1409H	probably benign	Het
Gm10696	T	C	3: 94,175,541	K321R	probably benign	Het
Hdac9	T	C	12: 34,303,220	S664G	possibly damaging	Het
Hibadh	A	G	6: 52,557,895	S167P	probably benign	Het
Hsdl1	A	G	8: 119,566,333	V121A	probably benign	Het
Ighv1-18	A	C	12: 114,683,049	I6S	possibly damaging	Het
Iqcm	T	A	8: 75,554,892	M1K	probably null	Het
Itch	T	C	2: 155,192,159	F417S	probably damaging	Het
Itpr1	C	T	6: 108,523,405	T2653I	possibly damaging	Het
Kank1	T	G	19: 25,424,220	Y1064D	probably damaging	Het
Kmt2c	T	C	5: 25,300,563	Q3249R	probably damaging	Het
Lefty1	T	C	1: 180,937,820	C318R	probably damaging	Het
Lmbr1l	C	T	15: 98,911,619	V147I	probably benign	Het
Meig1	C	A	2: 3,411,874	E37*	probably null	Het
Mpp3	A	G	11: 102,008,354		probably null	Het
Muc3	T	C	5: 137,146,816	N2S		Het
Mup7	T	C	4: 60,067,518	E199G	possibly damaging	Het
Nol4	G	C	18: 22,719,025	Y275*	probably null	Het
Nrxn1	G	A	17: 90,700,779	P429S	probably damaging	Het
Olfr761	T	C	17: 37,952,781	Y81C	probably damaging	Het
Pfkl	A	T	10: 77,994,162	F367L	probably damaging	Het
Pik3cg	T	C	12: 32,204,032	E652G	probably benign	Het
Prkag3	A	G	1: 74,744,821	I301T	probably benign	Het
Rcn1	G	A	2: 105,393,710	P163L	probably benign	Het
Slc1a7	G	A	4: 108,012,276	V513M	probably benign	Het
Slc37a2	A	T	9: 37,239,125		probably null	Het
Slc9b1	C	T	3: 135,394,030	T437I	possibly damaging	Het
Smap1	T	G	1: 23,849,441	T248P	probably benign	Het
Smpd3	A	C	8: 106,255,622	C617G	probably benign	Het
Spata20	T	C	11: 94,484,140	N212S	possibly damaging	Het
Sphkap	A	C	1: 83,278,962	C355W	probably damaging	Het
Spsb1	T	A	4: 149,907,109	M1L	probably damaging	Het
Srebf2	C	T	15: 82,178,765	R468C	probably damaging	Het
Stxbp5	A	C	10: 9,770,695		probably null	Het
Taar5	G	C	10: 23,971,222	D173H	possibly damaging	Het
Tfrc	A	G	16: 32,621,283	D438G	probably null	Het
Tinag	A	T	9: 76,999,849	I368K	probably benign	Het
Tm9sf1	A	G	14: 55,636,449	W531R	probably damaging	Het
Toporsl	A	G	4: 52,611,645	R513G	probably damaging	Het
Ttc30a1	T	C	2: 75,980,344	H465R	probably damaging	Het
Vat1	A	G	11: 101,466,130	S2P	probably benign	Het
Vmn2r107	C	G	17: 20,357,008	P423A	probably benign	Het
Vmn2r2	T	A	3: 64,117,387	E591V	probably damaging	Het
Vmn2r62	G	A	7: 42,764,607	T804I	probably damaging	Het
Vmn2r62	T	A	7: 42,787,857	Y401F	probably damaging	Het
Vmn2r89	A	T	14: 51,456,002	I270F	probably damaging	Het
Zfp418	T	C	7: 7,182,168	F377L	possibly damaging	Het
Zkscan5	T	C	5: 145,207,692	S182P	unknown	Het

Other mutations in Tnc

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00229:Tnc	APN	4	64016824	splice site	probably benign
IGL00531:Tnc	APN	4	63971153	splice site	probably benign
IGL00674:Tnc	APN	4	63965607	missense	probably damaging	1.00
IGL01015:Tnc	APN	4	64017334	missense	probably benign	0.19
IGL01090:Tnc	APN	4	64000080	missense	probably damaging	1.00
IGL01310:Tnc	APN	4	64013077	missense	probably benign	0.03
IGL01331:Tnc	APN	4	63982875	missense	probably damaging	0.99
IGL01393:Tnc	APN	4	64014054	splice site	probably benign
IGL01411:Tnc	APN	4	64000722	missense	probably damaging	0.96
IGL01472:Tnc	APN	4	64006419	missense	probably benign	0.00
IGL01552:Tnc	APN	4	63970408	missense	probably damaging	1.00
IGL01661:Tnc	APN	4	63970307	splice site	probably benign
IGL01669:Tnc	APN	4	64000701	missense	probably damaging	1.00
IGL01912:Tnc	APN	4	64008740	missense	probably damaging	1.00
IGL02028:Tnc	APN	4	63966672	splice site	probably benign
IGL02100:Tnc	APN	4	64000161	missense	possibly damaging	0.84
IGL02549:Tnc	APN	4	64015072	missense	probably damaging	1.00
IGL02642:Tnc	APN	4	63965579	splice site	probably benign
IGL02712:Tnc	APN	4	63975256	missense	probably damaging	1.00
IGL02876:Tnc	APN	4	64015101	missense	possibly damaging	0.56
IGL02886:Tnc	APN	4	64000107	missense	probably damaging	0.96
IGL02972:Tnc	APN	4	63976478	missense	probably benign	0.11
IGL03073:Tnc	APN	4	63971224	missense	possibly damaging	0.58
IGL03116:Tnc	APN	4	64014033	missense	probably damaging	1.00
IGL03181:Tnc	APN	4	63967306	missense	possibly damaging	0.95
IGL03358:Tnc	APN	4	64017615	nonsense	probably null
tancredo	UTSW	4	63993297	nonsense	probably null
BB009:Tnc	UTSW	4	64008620	missense	probably benign
BB019:Tnc	UTSW	4	64008620	missense	probably benign
P0020:Tnc	UTSW	4	64008857	missense	possibly damaging	0.63
PIT4377001:Tnc	UTSW	4	64017736	missense	probably damaging	1.00
PIT4403001:Tnc	UTSW	4	63964667	missense	probably damaging	1.00
PIT4468001:Tnc	UTSW	4	63964667	missense	probably damaging	1.00
R0243:Tnc	UTSW	4	63970420	missense	probably damaging	0.98
R0362:Tnc	UTSW	4	64017442	missense	probably damaging	1.00
R0410:Tnc	UTSW	4	64007694	missense	probably benign	0.00
R0420:Tnc	UTSW	4	64000159	missense	probably benign	0.00
R0540:Tnc	UTSW	4	64020455	missense	probably damaging	1.00
R0650:Tnc	UTSW	4	64008734	missense	probably benign	0.00
R1019:Tnc	UTSW	4	63962082	missense	probably damaging	1.00
R1102:Tnc	UTSW	4	64020468	missense	probably benign	0.05
R1126:Tnc	UTSW	4	64018120	missense	probably damaging	0.99
R1141:Tnc	UTSW	4	64013994	missense	probably damaging	1.00
R1142:Tnc	UTSW	4	64013994	missense	probably damaging	1.00
R1307:Tnc	UTSW	4	64008859	missense	probably damaging	0.98
R1322:Tnc	UTSW	4	64013994	missense	probably damaging	1.00
R1414:Tnc	UTSW	4	63965695	splice site	probably benign
R1470:Tnc	UTSW	4	63966574	missense	probably damaging	1.00
R1470:Tnc	UTSW	4	63966574	missense	probably damaging	1.00
R1499:Tnc	UTSW	4	63964754	missense	probably benign	0.15
R1506:Tnc	UTSW	4	64007684	missense	possibly damaging	0.90
R1597:Tnc	UTSW	4	64006384	missense	probably benign
R1750:Tnc	UTSW	4	63972735	missense	probably damaging	1.00
R1765:Tnc	UTSW	4	64013994	missense	probably damaging	1.00
R1783:Tnc	UTSW	4	64018096	missense	probably damaging	0.98
R1808:Tnc	UTSW	4	63999931	missense	probably damaging	1.00
R1903:Tnc	UTSW	4	64000062	missense	probably benign	0.00
R1932:Tnc	UTSW	4	63993025	critical splice donor site	probably null
R1941:Tnc	UTSW	4	64014964	missense	probably damaging	1.00
R1983:Tnc	UTSW	4	63984630	missense	possibly damaging	0.95
R2024:Tnc	UTSW	4	63964621	missense	probably damaging	1.00
R2075:Tnc	UTSW	4	63995666	missense	possibly damaging	0.94
R2327:Tnc	UTSW	4	63975238	missense	possibly damaging	0.78
R2444:Tnc	UTSW	4	64014963	missense	probably damaging	1.00
R2982:Tnc	UTSW	4	64020519	missense	possibly damaging	0.81
R3874:Tnc	UTSW	4	64008710	missense	probably damaging	1.00
R4110:Tnc	UTSW	4	64014951	missense	probably damaging	1.00
R4360:Tnc	UTSW	4	64016924	missense	probably benign	0.35
R4371:Tnc	UTSW	4	63970351	missense	probably damaging	1.00
R4434:Tnc	UTSW	4	64007829	missense	possibly damaging	0.91
R4438:Tnc	UTSW	4	64007829	missense	possibly damaging	0.91
R4570:Tnc	UTSW	4	63995672	missense	probably damaging	0.99
R4595:Tnc	UTSW	4	63995745	missense	probably damaging	1.00
R4749:Tnc	UTSW	4	63995639	missense	possibly damaging	0.56
R4756:Tnc	UTSW	4	63967343	missense	probably damaging	0.99
R4824:Tnc	UTSW	4	64017620	nonsense	probably null
R4957:Tnc	UTSW	4	63976556	missense	probably damaging	1.00
R4977:Tnc	UTSW	4	64006248	missense	possibly damaging	0.82
R5001:Tnc	UTSW	4	63984489	missense	probably damaging	1.00
R5001:Tnc	UTSW	4	64000062	missense	probably benign	0.16
R5015:Tnc	UTSW	4	64006502	missense	probably damaging	1.00
R5049:Tnc	UTSW	4	64017986	missense	probably damaging	1.00
R5066:Tnc	UTSW	4	63975229	missense	probably damaging	0.96
R5073:Tnc	UTSW	4	64020411	missense	probably damaging	1.00
R5116:Tnc	UTSW	4	63967215	critical splice donor site	probably null
R5195:Tnc	UTSW	4	63967252	missense	probably damaging	1.00
R5200:Tnc	UTSW	4	63971278	missense	probably damaging	1.00
R5221:Tnc	UTSW	4	63993297	nonsense	probably null
R5237:Tnc	UTSW	4	63962096	missense	probably damaging	1.00
R5265:Tnc	UTSW	4	63993206	missense	probably benign	0.00
R5275:Tnc	UTSW	4	63964730	nonsense	probably null
R5346:Tnc	UTSW	4	64008655	missense	probably benign
R5409:Tnc	UTSW	4	63966536	missense	probably damaging	1.00
R5409:Tnc	UTSW	4	64007417	missense	probably damaging	1.00
R5469:Tnc	UTSW	4	64013925	splice site	probably null
R5518:Tnc	UTSW	4	64017679	missense	probably damaging	1.00
R5560:Tnc	UTSW	4	64008709	missense	probably damaging	1.00
R5588:Tnc	UTSW	4	64006422	missense	possibly damaging	0.57
R5686:Tnc	UTSW	4	64007730	splice site	probably null
R5686:Tnc	UTSW	4	64008795	missense	possibly damaging	0.78
R5837:Tnc	UTSW	4	64013214	missense	probably damaging	1.00
R5976:Tnc	UTSW	4	64018166	missense	probably benign	0.17
R6156:Tnc	UTSW	4	63970352	missense	probably damaging	1.00
R6182:Tnc	UTSW	4	64008796	missense	probably damaging	0.99
R6360:Tnc	UTSW	4	64000733	missense	probably damaging	1.00
R6416:Tnc	UTSW	4	64007816	missense	probably benign	0.05
R6778:Tnc	UTSW	4	63995598	missense	probably benign	0.12
R6798:Tnc	UTSW	4	63965604	missense	probably benign	0.02
R6799:Tnc	UTSW	4	63965604	missense	probably benign	0.02
R6943:Tnc	UTSW	4	63982745	missense	probably damaging	0.97
R7027:Tnc	UTSW	4	63984589	missense	probably benign	0.02
R7183:Tnc	UTSW	4	64013128	missense	probably damaging	1.00
R7204:Tnc	UTSW	4	63971155	splice site	probably null
R7317:Tnc	UTSW	4	63972722	missense	probably damaging	0.99
R7323:Tnc	UTSW	4	63971232	missense	probably damaging	0.96
R7327:Tnc	UTSW	4	63964762	splice site	probably null
R7382:Tnc	UTSW	4	64014043	nonsense	probably null
R7399:Tnc	UTSW	4	64020657	start gained	probably benign
R7479:Tnc	UTSW	4	64017628	missense	possibly damaging	0.95
R7585:Tnc	UTSW	4	64020411	missense	probably damaging	1.00
R7932:Tnc	UTSW	4	64008620	missense	probably benign
R7947:Tnc	UTSW	4	64017343	missense	probably damaging	1.00
R7991:Tnc	UTSW	4	64008746	missense	probably benign	0.42
R8004:Tnc	UTSW	4	63984657	missense	probably benign	0.04
R8080:Tnc	UTSW	4	63976469	missense	possibly damaging	0.52
R8109:Tnc	UTSW	4	64008763	missense	probably benign	0.11
R8145:Tnc	UTSW	4	64017479	missense	probably benign
R8340:Tnc	UTSW	4	64007799	missense	probably damaging	1.00
R8360:Tnc	UTSW	4	63967274	missense	probably benign	0.00
R8671:Tnc	UTSW	4	64017446	missense	probably damaging	1.00
R8691:Tnc	UTSW	4	63962076	missense	probably damaging	1.00
R8759:Tnc	UTSW	4	64006264	missense	possibly damaging	0.86
R8864:Tnc	UTSW	4	63993059	missense	probably damaging	0.98
R8927:Tnc	UTSW	4	64007358	missense	probably damaging	1.00
R8928:Tnc	UTSW	4	64007358	missense	probably damaging	1.00
R8949:Tnc	UTSW	4	64008850	missense	probably damaging	1.00
R8956:Tnc	UTSW	4	64000733	missense	probably damaging	1.00
R9016:Tnc	UTSW	4	64017094	missense	probably benign	0.23
R9049:Tnc	UTSW	4	64000010	missense	possibly damaging	0.83
R9097:Tnc	UTSW	4	63970385	missense	possibly damaging	0.62
R9114:Tnc	UTSW	4	63972736	missense	probably benign	0.03
R9151:Tnc	UTSW	4	64020449	missense	possibly damaging	0.46
R9488:Tnc	UTSW	4	63995705	missense	probably damaging	0.99
R9537:Tnc	UTSW	4	63966584	missense	probably damaging	0.99
R9666:Tnc	UTSW	4	64007808	missense	probably damaging	1.00
R9700:Tnc	UTSW	4	64014949	missense	probably damaging	0.99
R9703:Tnc	UTSW	4	63971175	missense	probably benign	0.00
R9771:Tnc	UTSW	4	64007363	missense	probably damaging	1.00
S24628:Tnc	UTSW	4	64018012	missense	probably damaging	1.00
Z1177:Tnc	UTSW	4	63960544	critical splice acceptor site	probably null
Z1177:Tnc	UTSW	4	64007426	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TCCATACAGCAGCAATGTGTTG -3'
(R):5'- AGATGACCTGGCCTATGAGTAC -3'

Sequencing Primer
(F):5'- CCTTAGAACTATGTCACGCGATGG -3'
(R):5'- CTTTGTCATTCAGGTACAGGAAGCC -3'

Posted On

2020-09-15